Table 6

PCR primer sets used in this study
Gene set Sequence
vGI-1b: (internal gene primer sets)
MAP0101.F GGTTACCGACTTGGTCCAGA
MAP0101.R CCCGTCAGATCCATTACGAC
MAP0103.F2 GAGCGCCAACCTATCTCAAC
MAP0103.R TGGTTTGGAGATCCCTGAAG
vGI-19 (internal gene primer set)
MAP3733c.F TTCATGTTGTTCCTCACCCG
MAP3733c.R CATCGCGAGCGTAGCCGCTG
vGI-20 (internal gene primer set)
MAP1723.F GGAGTATGGAACCATCGCTG
MAP1723.R TGATGTAACGGGCGTGCAAG
vGI-21 (specific for tandem duplicated region in IIUK2000/1)
MAP2705.SEQ2 CGATGAAGGCCTACTGGTC
MAP2733.R TCAACTGGCTCCTCCTTTTG
vGI-22 (specific for tandem duplicated region in 316FNLD1978)
MAP1789.F TTTGGCACTACAACGAGCTG
MAP1750.R GATCGAGAAGAGGGGAGTCA
MAP2114c (single copy gene for control PCR)
MAP2114c.F TGGAAGCTACCCAAATCACC
MAP2114c.R GAGAAGTAGGCCGCGTAGTC
IS900
AV-1 ATGTGGTTGCTGTGTTGGATGG
AV-2 CCGCCGCAATCAACTCCAG
pre16SrRNA
pre16SrRNA.R GCGCAGCGAGGTGAATTT
pre16SrRNA.F TTTGGCCATACCTAGCACTCC
Tellurite (tehB)
MAP3730.F GGTTTGACGACAGAGATGCG
MAP3730.R GGCATGGTGTACGACAAGGA
MIRU3 (MAP3981-2)
MIRU3.F ACATTCACCCTGTCCATTCC
MIRU3.R CCTCCTTACGGAGCAGGAA
IS900(MAP0034)
MAP0033c.F AGCTGCCGGGAGTTGATCT
MAP0035.R TCACGGCTCACCGCACGCT
IS900(MAP0159c)
MAP0158.F CCCGTGACAAGGCCGAAGA
MAP0160.R CGTTTTGCACCTCGATGGCC
IS900(MAP0967)
MAP0966c-MAP0967.F CGTGACGAACGACATGTGTT
MAP0967-MAP0968.R GCTCGAGACATTTAGCCCAC
IS900(MAP1033)
MAP1032c.F GTAGAACCCGACCAGCAGC
MAP1034c.R GACCTGGCACCTGTATCCC
IS900(MAP1722)
MAP1720-MAP1721c.F CTAAGGTGGCCAGCGTTTCT
MAP1723.R GGTTGGAGACAACCTCGTTC
IS900(MAP1771c)
MAP1770c.F ACAATTCGGCGATCGTCTCG
MAP1772.R CGCGGACAGACACAGGTAGG
IS900(MAP1785)
MAP1784c.F GTCGACCATCGCTCTTCCCT
MAP1786c.R ATCGGTGTCGAGGACATTCC
IS900(MAP1793c)
MAP1792.F CAATGGATGGTCGTCACCTG
MAP1794.R CGGCCCGCTTGATCCATTTG
IS900(MAP2034c)
MAP2033-MAP2034c.F CCGCAAGTAGTGCACTATGG
MAP2035.R TATTCGGGGTTGTTCAGGGA
IS900(MAP2108)
MAP2105.F CAGGCACGGAACACAGTTCG
MAP2109c.R TGTTCGGCTACGGCATACTG
IS900(MAP2157)
MAP2156.F CTGCAAACACAGCCCAATC
MAP2158.R CAACTTCGGCAAGTTCACC
IS900(MAP2203c)
MAP2202c.F TCCCGGTAGAAGATCATGTG
MAP2204c.R GACAATCTGCCGTCGTATCA
IS900(MAP2444c)
MAP2443.F AACCTTGACCCACACCTTCC
MAP2445.R TGAGCTCGCCGGCGAAATA
IS900(MAP2577)
MAP2567c.F CGTTCTGGGCATCCATCGACG
MAP2578.R TCACGGCGGTCAGGTTACTTC
IS900(MAP3480)
MAP3479c.F GTTGAACTTTCCGACCAACC
MAP3480-3481.R GGTTAGCGGGAGAAAAGCTC
IS900(MAP4066)
MAP4065.F TGGGCCTGAGGTCAGAACCA
MAP4067c.R GAAGACCACCTCTACCTCAC
IS900(MAP4281)
MAP4280.F GCTGACCGAGAAGGGCTAC
MAP4282.R CGTAAGTGACTGGCTCATGG

MAP gene annotation corresponds to GenBank AE016958.

Bull et al.

Bull et al. BMC Microbiology 2013 13:11   doi:10.1186/1471-2180-13-11

Open Data