Table 1

Sequence of primers used to amplify amastin isoforms ORFs.
Primer name / gene ID Primer Sequence (5’-3’) Restriction enzyme
pδ1-amastin (F) Tc00.1047053511071.40 TTGT
    TCTAGA
GTAGGAAGCAATG
XbaI
pδ1-amastin (R) Tc00.1047053511071.40 CGCT
    GGATCC
GAACCACGTGCA
BamHI
β1-amastin (F) Tc00.1047053509965.390
    CCTAGG
AGGATGTCGAAGAAGAAG
AvrII
β1-amastin (R) Tc00.1047053509965.390
    AGATCT
CGAGCACAATGAGGCCCAG
BglII
β2-amastin (F) Tc00.1047053509965.394
    TCTAGA
TGGGCTTCGAAACGCTTGC
XbaI
β2-amastin (R) Tc00.1047053509965.394
    GGATCC
CCAGTGCCAGCAAGAAGACTG
BamHI

The underlined sequences correspond to the restriction sites recognized by the restriction enzyme.

Kangussu-Marcolino et al.

Kangussu-Marcolino et al. BMC Microbiology 2013 13:10   doi:10.1186/1471-2180-13-10

Open Data