Table 2

PCR primers used in this study

Primer

Sequence (5'-3')

Description


1127

GTTGAAGCAATATTGAAGAAAGC

sssF screen forward


1128

TTCTTCATTTAGTTTACCCATATCAAC

sssF screen reverse


839

GCTA

    GGATCC
TCCATCTAATTCAAATGACAACG

sssF cloning forward. Contains BamHI site (underlined)


840

ACTA

    GGATCC
GCTCCATTCAAAGTTCCACTTAC

sssF cloning reverse. Contains BamHI site (underlined)


873

GCTCA

    CTCGAG
TTCGACACCATCAGTAGAAGC

sssF fragment PCR for cloning into pBAD/HisB, for antibody production, forward. Contains XhoI site (underlined)


874

GCTCG

    GAATTC
AAGCGCTTTAGCTTTAGCATC

sssF fragment PCR for cloning into pBAD/HisB, for antibody production, reverse. Contains EcoRI site (underlined)


1001

AAAAAAGCTTATAATTATCCTTAAGTCACTACTATGTGCGCCCAGATAGGGTG

sssF TargeTron IBS


1002

CAGATTGTACAAATGTGGTGATAACAGATAAGTCTACTATCTTAACTTACCTTTCTTTGT

sssF TargeTron EBS1d


1003

TGAACGCAAGTTTCTAATTTCGATTTGACTTCGATAGAGGAAAGTGTCT

sssF TargeTron EBS2


2065

AAAAAAGCTTATAATTATCCTTATCGTACGGCAAGGTGCGCCCAGATAGGGTG

sasF TargeTron IBS


2066

CAGATTGTACAAATGTGGTGATAACAGATAAGTCGGCAAGATTAACTTACCTTTCTTTGT

sasF TargeTron EBS1d


2067

TGAACGCAAGTTTCTAATTTCGGTTTACGATCGATAGAGGAAAGTGTCT

sasF TargeTron EBS2


2084

CAGT

    AAGCTT
TGTTAGCGACATGGACAATATG

sasF cloning forward. Contains HindIII site (underlined)


2085

CCGT

    AAGCTT
TTGCATATACTTCACAATAAATTAAGG

sasF cloning reverse. Contains HindIII site (underlined)


1011

TTCTTTAGGTGATGAACATATCAGG

Sequencing primer to check for correct 350 bp retargeted intron fragments for TargeTron


EBSU

CGAAATTAGAAACTTGCGTTCAGTAAAC

TargeTron EBS universal


King et al. BMC Microbiology 2012 12:8   doi:10.1186/1471-2180-12-8

Open Data