Table 2

Primers and amplification conditions
Locus Function Putative gene product Gene sizea(bp) Locus positiona(bp) Primerb Primer sequence 5’-3’ Sequence length amplified (alignment length) (bp) Amplification conditions
dnaK Stress response Heat shock 70 kDa protein (HSP 70) 1,928 3357741

DnaK-F

DnaK-R

ATGAAGAAGACCGCCGAAG

TGCAGCACGTGAATGGTC

816

(816)

45s at 94°C;

45s at 63°C;

45s at 72°C

gltA Glycolytic pathway Type II citrate synthase 1,286 2098162

GltA-F

GltA-R

TTCCGTCTGCTCTCCAAGAT

GCAGCGGATCCTTGATCT

462

(462)

45s at 94°C;

45s at 63°C;

45s at 72°C

gyrB Replication Subunit DNA gyrase 2,411 3883

GyrB3F

GyrB14R

(Yáñez, 2003)

783-786

(792)

45s at 94°C;

45s at 65°C;

45s at 72°C

radA DNA repair DNA repair protein, RadA 1,364 4108941

RadA-F

RadA-R

ATGCATCACCTGGATGGAGT

TGCCTATGTTTGTACCGAATG

405-414

(420)

45s at 94°C;

45s at 60°C;

45s at 72°C

rpoB Transcription DNA-directed RNA polymerase β subunit 4,091 4466890

Pasrpob-L

Rpob-R

(Korczak, 2004)

426

(426)

45s at 94°C;

45s at 65°C;

45s at 72°C

tsf Protein translation Elongation factor Ts 881 1272267

Tsf-F

Tsf-R

CGCTGGCATGATGGATTG

GATGCCTTCGCCCACTTC

702

(702)

45s at 94°C;

45s at 65°C;

45s at 72°C

zipA Cell division Cell division protein ZipA 1,112 1337458

ZipA-F

ZipA-R

TTGCGTTACATCTTGGTTGC

ATCCGGTACGGATTGAAGGT

429-507

(537)

1min at 94°C;

45s at 55°Cc;

1min at 72°C

aGene start codon position on the circular chromosome sequence of A. hydrophila subsp. hydrophila ATCC 7966T (accession number NC_008570).

bF, forward primer; R, reverse primer.

cSome strains belonging to A. caviae and A. media clades were amplified using a 4 mM MgCl2 concentration and a primer hybridization temperature of 50°C (A. caviae).

Roger et al.

Roger et al. BMC Microbiology 2012 12:62   doi:10.1186/1471-2180-12-62

Open Data