Table 2

List of primers and their related properties used in this study

Primer set

Sequence (5'-3')

(forward/reverse)

Reference locus in strain Psy62 (CP001677)

Annotation

Reference


OI1/OI2c

GCGCGTATGCAATACGAGCGGCA/GCCTCGCGACTTCGCAACCCAT

CLIBASIA_r05781

16S rRNA gene

Jagoueix et al., 1994

ITSAf/ITSAr

GGGGGTCGTTAATATTTGGTT/GTCGCATACAATGCCAACAT

CLIBASIA_r05778 to CLIBASIA_r05781

16S-23S rRNA gene and intergenic sequence

Deng et al., 2008

LapGP-1f/LapGP-1r

GACATTTCAACGGTATCGAC/GCGACATAATCTCACTCCTT

CLIBASIA_01645

bacteriophage repressor protein C1

Chen et al., 2010

Lap5640f/Lap5650r

TCTGTGATGCCGTTTGTAGG/CCAAATCAGCCAGCTCAAAT

CLIBASIA_05640 to CLIBASIA_05650

Putative transferase

This study


PCR amplifications were carried out in 25-μl volumes that include 2 μl of template DNA, 0.4 μl of each 10 μM forward and reverse primer, 2.5 μl of 2.5 mM deoxynucleoside triphosphate, and 0.3 μl of EX Taq DNA polymerase at 5 U/μl (Takara Bio Inc., Japan). Thermal cycling comprised an initial denaturing of 96°C for 1 min, followed by 35 cycles of amplification (96°C for 30 s, 55°C for 30 s, and 72°C for 30 s) and a final extension for 4 min. PCR products were electrophoresed in a 1.5% agarose gel and visualized by ethidium bromide staining under UV light.

Wang et al. BMC Microbiology 2012 12:18   doi:10.1186/1471-2180-12-18

Open Data