Table 2

rrsgene based primers used for qPCR quantification and PCR-DGGE
Target organism Primer set Primer sequences 5' - 3' Assay Reference
Total bacteria 520 F AGCAGCCGCGGTAAT qPCR [14]
799 R2 CAGGGTATCTAATCCTGTT
Fibrobacter FibSuc3F GCGGGTAGCAAACAGGAT TAGA qPCR [15]
succinogenes FibSuc3R CCCCCGGACACCCAGTAT
Ruminococcus RumAlb3F TGTTAACAGAGGGAAGCAAAGCA qPCR [15]
albus RumAlb3R TGCAGCCTACAATCCGAACTAA
Ruminococcus RumFla3F TGGCGGACGGGTGAGTAA qPCR [15]
flavefaciens RumFla3R TTACCATCCGTTTCCAGAAGC T
Genus PrevGen4F GGTTCTGAGAGGAAGGTCCCC qPCR [15]
Prevotella PrevGen4R TCCTGCACGCTACTTGGCTG
Streptococcus StrBov2F TTCCTAGAGATAGGAAGTTTCTTC GG qPCR [15]
bovis StrBov2R ATG ATG GCA ACT AAC AAT AGG GGT
Genus Lacto 05 F AGC AGT AGG GAA TCT TCC A qPCR [16]
Lactobacillus Lacto 04R CGCCACTGGTGTTCYTCCATATA
Total bacteria GC + Eub340F CGCCCGCCGCGCGCGGCGGGCGGGGCG GGGGCACGGGGGGTCCTACGGGAGGCAGCAG DGGE [17-19]
HDA2R GTA TTA CCG CGG CTG CTG GCA C

Lettat et al.

Lettat et al. BMC Microbiology 2012 12:142   doi:10.1186/1471-2180-12-142

Open Data