Table 2

Oligonucleotide primers used in this study
Primer Sequence 5’ - 3’ Strand Target Reference
K1153 CCGGAATTCTGCCGATGGCACCAGACA + LEE4 [14]
K1150 CGCGGATCCTGCCAAACATCGCCAAAGTAG LEE4 [14]

Mellies et al.

Mellies et al. BMC Microbiology 2012 12:123   doi:10.1186/1471-2180-12-123

Open Data