Table 1

Oligonucleotides used in transposon detection

Transposon region

Oligo nucleotide

Sequence

Amplicon size (bp)

Transposon presumed present

S. pneumoniae population screened

Reference


int gene

int_for

GCGTGATTGTATCTCACT

1046

Tn916

Dual-positive, erm(B)-positive, mef(E)-positive

[29]


int_rev

GACGCTCCTGTTGCTTCT

[29]


xis gene

xis_for

AAGCAGACTGAGATTCCTA

193

Tn916

Dual-positive, erm(B)-positive, mef(E)-positive

[29]


xis rev

GCGTCCAATGTATCTATAA

[29]


tnpRgene

O21

CCAAGGAGCTAAAGAGGTCCC

1528

Tn917

Dual-positive, erm(B)-positive, mef(E)-positive

[29]


O22

GTCCCGAGTCCCATGGAAGC

[29]


tnpA gene

O23

GCTTCCATGGGACTCGGGAC

2115

Tn917

Dual-positive, erm(B)-positive, mef(E)-positive

[29]


O24

GCTCCCAATTAATAGGAGA

[29]


Spans insert of erm(B) elements in Tn916

J12d

ATTCCCATTGAAGACGCAGAAGT

800

Tn3872

erm(B)-positive that are Tn916-positive

[34]


J11d

CTACCGCACTTCGTTTGGTGTAC

3600

Tn6002

[34]


7900

Tn6003 or Tn1545


Junction of mega insert and Tn916

SG1

CTCACTGCACCAGAGGTGTA

1000

Tn2009 or Tn2010

Dual-positive and mef(E)-positivie that are Tn916-positive

[30]


LTf

GCAGAGTATACCATTCACATCGAAGTTCCAC

30]


Junction of erm(B) element and Tn916

EB2

AGTAATGGTACTTAAATTGTTTAC

3300

Tn2010

Dual-positive that are Tn916-positive

[31]


TN2a

GAAGTA(G/C)AAGCTAAAGATGG

[32]


a Modified from original to change melt temperature or incorporate degeneracies

Bowers et al. BMC Microbiology 2012 12:12   doi:10.1186/1471-2180-12-12

Open Data