Table 2

PCR primers

Gene annotation

Locus

Sequence*

Annealing temperature


histone H2B

GL50803_121046

F:CGCCTGATGAAGAAGACG

R:GTGTTCCGCTTGCTGA

60


14-3-3 protein

GL50803_6430

F:CGGTATGGAAGGCGAGCT

R:GCTTGAGGATGTCGTTGC

61


Giardia troph antigen GTA-1

GL50803_17090

F:GCCCGTAGAGTTCTGG

R:CGTCACTATCTCCCCG

61


ubiquitin

GL50803_7110

F:GTTGAGCCCACAGATACC

R:GTTACCACCACGGAGG

61


β-giardin

GL50803_4812

F: ATGTTCACCTCCACCC

R: CGGAAGTTTGCAGCCA

62


centrin

GL50803_6744

F: GCAAACCAAACGCTCG

R: CCAGACGTATCCACCTC

61


α-tubulin

GL50803_103676

F: CAAGTACATGGCGTGCTGCATGAT

R:TAGTTGATGCCGACCTTGAAGCCT

61


SALP-1

GL50803_4410

F: CCGCGCCGACCCCACG

R: GCTCATCCAGCATCTTGTCC

61


endothelin-converting enzyme 2

GL50803_4349

F:CATATCACCTTCCTGA

R:GACCTGGGAGACATCAATGG

61


mitotic spindle checkpt. MAD2

GL50803_100955

F:GGCTACCCAGACCAAG

R:CCCGCCTATCGGAAGA

61


*F, forward primer; R, reverse primer

Faghiri and Widmer BMC Microbiology 2011 11:91   doi:10.1186/1471-2180-11-91

Open Data