Table 1

Forward (F) and reverse (R) PCR primers employed for molecular identification of all Aspergillus species of section Fumigati and for Aspergillus fumigatus.

Primers (5'- 3')

Fragment length


Aspergillus section Fumigati

β-tubulin

F

AGGCAGACCATCTCTGGTGAG

153 bp


R

TCGGAGGAGCCATTGTAGC


Rodlet A

F

CCAGGCTCAGCTCTCTTGCT

105 bp


R

CCACCACCGATGAGGTTCTT


A. fumigatus

β-tubulin

F

TGACGGGTGATTGGGATCTC

198 bp


R

CGTCCGCTTCTTCCTTGTTT


Rodlet A

F

ACATTGACGAGGGCATCCTT

313 bp


R

ATGAGGGAACCGCTCTGATG


Serrano et al. BMC Microbiology 2011 11:82   doi:10.1186/1471-2180-11-82

Open Data