Table 2

Validation of microarray data using qRT-PCR of randomly selected genes relative to the housekeeping gene, rpoDa

Locusb

Namec

Primer sequenced

Fragment (bp)e

Serovar Typhimurium Gene Functionf

Ratio of arcA mutant/WT

Log2 ratio


qRT-PCRg

Microarrayh

qRT-PCRi

Microarrayj


STM3217

aer

5'-CGTACAACATCTTAATCGTAGC-3'

5'-TTCGTTCAGATCATTATTACCC-3'

163

aerotaxis sensor receptor, senses cellular redox state or proton motive force

0.237

0.293

-2.1

-1.8


STM1919

cheM

5'-GCCAATTTCAAAAATATGACG-3'

5'-GTCCAGAAACTGAATAAGTTCG-3'

114

methyl accepting chemotaxis protein II, aspartate sensor-receptor

0.194

0.261

-2.4

-1.9


STM0441

cyoC

5'-TATTTAGCTCCATTACCTACGG-3'

5'-GGAATTCATAGAGTTCCATCC-3'

134

cytochrome o ubiquinol oxidase subunit III

4.920

5.465

2.3

2.5


STM1803

dadA

5'-TAACCTTTCGCTTTAATACTCC-3'

5'-GATATCAACAATGCCTTTAAGC-3'

155

D-amino acid dehydrogenase subunit

3.430

10.520

1.8

3.4


STM2892

invJ

5'-TTGCTATCGTCTAAAAATAGGC-3'

5'-TTGATATTATCGTCAGAGATTCC-3'

128

surface presentation of antigens; secretory proteins

0.855

1.010

-0.2

0.0


STM2324

nuoF

5'-GGATATCGAGACACTTGAGC-3'

5'-GATTAAATGGGTATTACTGAACG-3'

163

NADH dehydrogenase I chain F

0.380

1.706

-1.4

0.8


STM0650

STM0650

5'-CAACAGCTTATTGATTTAGTGG-3'

5'-CTAACGATTTTTCTTCAATGG-3'

130

putative hydrolase C-terminus

0.274

0.123

-1.9

-3.0


STM2787

STM2787

5'-AAGCGAATACAGCTATGAACC-3'

5'-ATTAGCTTTTGCAGAACATGG-3'

144

tricarboxylic transport

6.440

90.770

2.7

6.5


STM4463

STM4463

5'-AAGGTATCAGCCAGTCTACG-3'

5'-CGTATGGATAAGGATAAATTCG-3'

142

putative arginine repressor

0.165

0.012

-2.6

-6.4


STM2464

eutN

5'-AGGACAAATCGTATGTACCG-3'

5'-ACCAGCAGTACCCACTCTCC-3'

153

putative detox protein in ethanolamine utilization

0.181

0.159

-2.5

-2.7


STM2454

eutR

5'-GGTAAAAGAGCAGCATAAAGC-3'

5'-ATTATCACTCAAGACCTTACGC-3'

118

putative regulator ethanolamine operon (AraC/XylS family)

0.189

0.188

-2.4

-2.4


STM2470

eutS

5'-AATAAAGAACGCATTATTCAGG-3'

5'-GTTAAAGTCATAATGCCAATCG-3'

137

putative carboxysome structural protein, ethanol utilization

0.197

0.105

-2.3

-3.3


STM1172

flgM

5'-AGCGACATTAATATGGAACG-3'

5'-TTTACTCTGTAAGTAGCTCTGC-3'

126

anti-FliA (anti-sigma) factor; also known as RflB protein

0.196

0.163

-2.4

-2.6


STM3692

lldP

5'-TGATTAAACTCAAGCTGAAAGG-3'

5'-CCGAAATTTTATAGACAAAGACC-3'

189

LctP transporter, L-lactate permease

5.950

12.780

2.6

3.7


STM3693

lldR

5'-GAACAGAATATCGTGCAACC-3'

5'-GAGTCTGATTTTCTCTTTGTCG-3'

153

putative transcriptional regulator for lct operon (GntR family)

5.750

80.000

2.5

6.3


STM1923

motA

5'-GGTTATCGGTACAGTTTTCG-3'

5'-TAGATTTTGTGTATTTCGAACG-3'

194

proton conductor component of motor, torque generator

0.282

0.253

-1.8

-2.0


STM4277

nrfA

5'-GACTAACTCTCTGTCGAAAACC-3'

5'-ATTTTATGGTCGGTGTAGAGC-3'

159

nitrite reductase periplasmic cytochrome c(552)

0.314

0.285

-1.7

-1.8


aSTM3211 (rpoD) is a housekeeping gene that was used as the reference gene where no significant

change in expression level was observed. The primer sequences (5' to 3') used for rpoD were as follows: CGATGTCTCTGAAGAAGTGC (forward) and TTCAACCATCTCTTTCTTCG (reverse). The size of the fragment generated is 150 bp.

bLocation of the open reading frame (ORF) in the S. Typhimurium LT2 genome.

cRespective gene name or symbol.

dFor each set, the first primer is the forward primer and the second primer is the reverse primer.

eSize of the amplified PCR product.

fFunctional classification according to the KEGG (Kyoto Encyclopedia of Genes and Genomes) database.

gExpression levels of quantitative reverse transcriptase polymerase chain reaction - values shown as the ratio between the arcA mutant and the wild-type; where values <1 indicate that ArcA acts as an activator, and values >1 indicate ArcA acts as a repressor.

hExpression levels from the microarray data - values shown as the ratio between the arcA mutant and the wild-type; where values <1 indicate that ArcA acts as an activator, and values >1 indicate ArcA acts as a repressor.

iExpression levels of quantitative reverse transcriptase polymerase chain reaction comparing the arcA mutant versus the wild-type - shown in signal to log2 ratio (SLR).

jExpression levels of microarray data comparing the arcA mutant versus the wild-type - shown in signal to log2 ratio (SLR).

Evans et al. BMC Microbiology 2011 11:58   doi:10.1186/1471-2180-11-58

Open Data