Table 2

Primers used in this study.

Target gene

Primer sequences (5' → 3')

Amplicon size (bp)

Application


ef1415

F:TGTTGCGGTTTCTGCATTAG

2818

PCR on junction between EF1415 and EF1417

ef1417

R:GCATCTCGATAGACAATTCG

PCR on junction between EF1415 and EF1417

ef1489

F:GAATCGAACTAGCATTTTTGGG

465

PCR on junction between EF1489 and EF1490

ef1490

R:ATGGAACGAACCATTGGAAA

PCR on junction between EF1489 and EF1490

ef1843

F:GGAGCCGTTAGACAGACAGC

2457

PCR on junction between EF1843 and EF1847

ef1847

R:GCTTGCTTTACAGCCTCAAGA

PCR on junction between EF1843 and EF1847

ef1895

F:GCACAACAAATTTCAATTCCA

4573

PCR on junction between EF1895 and EF1898

ef1898

R:ATTGAAGTGGTTCGCTACGG

PCR on junction between EF1895 and EF1898

ef2239

F:AACTGCTGTCAAGCGTAGCA

1252

PCR on junction between EF2239 and EF2240

ef2240

R:TGTGGCATTTTGGACTGTTG

PCR on junction between EF2239 and EF2240

ef2350

F:ATAACTGAGTGATTTTCACAATTGC

654

PCR on junction between EF2350 and EF2352

ef2352

R:GATCCGTGGAAGTTCCTCAA

PCR on junction between EF2350 and EF2352

ef3216

F:TCGGCGTTGAAGACTATGAA

-

Sequencing of junction between EF3216 and EF3230

ef3217

F:ATTGGGAATGACGGCTACAC

R:TTGCGTATTTCGCAGCATAA

499

PCR

ef3218

F:TCGCGTAGTAGGAGCAATCA

R:TTTTGTTCAGTTCCCACACCT

396

PCR

ef3220

F:AGCTTTTGGCGAAGGAGATT

R:TTTATTGCGGGTTCCTCAGT

495

PCR

ef3221

F:TGAACGAAAATGAAGGTGGT

R:TCATCAATCTCCAACGCATC

196

PCR

ef3222

F:CAAAGAAGAATCAGCCGATTAAA

R:ATATTTGGGCATTTGCATGG

183

PCR

ef3223

F:AATTGGGAAAAAGGGGTCAG

R:TTCGTGATCTGCTTGTTGTTCT

501

PCR

ef3224

F:GTTGGGCTGGACGTATGAAT

R:TGTGGCTTTATAGGCTGTAGCA

214

PCR

ef3225

F:ATTACTTCACCGCCCATGAC

R:CGCTGGAAGTCTGCTCTTG

474

PCR

ef3226

F:GATGATTTAACCGCACAAGGA

R:TTTTTATTTCGAGCGGATGC

499

PCR

ef3227

F:ACAGGAAGCCATTCACAAACT

R:CTGATTCGTGGAAGTCCAACT

162

PCR

ef3230

R:TCCTGACTTCCGTTCTGCTT

-

Sequencing of junction between EF3216 and EF3230

hmpref0346_1861

F:CGAGTTAGAGGAAGCGTTGG

630

PCR

R:CCAGACAATTTGGGCGTACT

hmpref0346_1864

F:GAAATTTTCTGAAAGTGAAGACAAGA

299

PCR

R:TGATTAGCAGTCACAACAGCAA

hmpref0346_1868

F:TGTACACAAGCTACCCGGATT

538

PCR

R:TTCCCACCTGCGTCTATTTT

hmpref0348_0427

R:GAGACTTCAACCACTCCACAAAAACC

-

Sequencing of gap between contig00034-35 in TX0104

hmpref0348_0428

F:CCTGTAGAAGTATTGTCCATTTTAACGCTATC

Sequencing of gap between contig00034-35 in TX0104


Solheim et al. BMC Microbiology 2011 11:3   doi:10.1186/1471-2180-11-3

Open Data