Table 1

Primers for qPCR analysis

Gene

Forward primer (5' → 3')

Reverse primer (5'→ 3')


emhA

CGGTGAGCCGTCAGGAATAC

TTGATCTGGGCGCTTTGC

emhB

GTCCCACTGGCGATTTCC

CCGTGATCATACCGCCAATAA

emhC

GATCGCCTGGCGCAACT

CTTTCGCAGTCTGCTCATTCC

16S rRNA

GGAGACTGCCGGTGACAAACT

TGTAGCCCAGGCCGTAAGG


Adebusuyi and Foght BMC Microbiology 2011 11:252   doi:10.1186/1471-2180-11-252

Open Data