Table 1

PCR primers used

Primer

Sequence (5'→3')

16S rDNA region

Product size

Reference


A2+V1 F

GCCTCCCTCGCGCCATCAGAGAGTTTGATCMTGGCTCAG

V1V2

392 bp3

[32]

B2+V2 R

GCCTTGCCAGCCCGCTCAGCYNACTGCTGCCTCCCGTAG

8-3611

A2+1061R

GCCTCCCTCGCGCCATCAGCRRCACGAGCTGACGAC

V6

316 bp3

[33]

B2 +784F

GCCTTGCCAGCCCGCTCAGAGGATTAGATACCCTGGTA

784-10611


The table contains primer name, sequence (hypervariable specific sequence in bold font), 16S rDNA region covered, product size and references for the primers used in this study.

1 Coordinates are given relative to the 1542 bp E. coli K12 16S rDNA sequence.

2A and B primer: corresponds to 454-adaptor sequences from the amplicon pyrosequencing protocol for GS FLX http://www.my454.com/downloads/protocols/Guide_To_Amplicon_Sequencing.pdf webcite[101], p. 7.

3Product size includes the primer sequences.

Siddiqui et al. BMC Microbiology 2011 11:244   doi:10.1186/1471-2180-11-244

Open Data