Table 2

Synthetic oligonucleotides

Name

Sequence (5' - 3')a

Position of annealing b


uvrA-Ms-Y

ctag

    tctaga
gacgtgtccggtgtaggtgt

-180/-160

uvrA-Ms-R

ctag

    tctaga
atgacctggtggatcgactg

+150/+169

uvrA-Tb-F

ctag

    tctaga
cgatgccttgaggatcgtg

-258/-240

uvrA-Tb-R

ctag

    tctaga
gaagatcgaaacccgatacg

+194/+213


a Underlined is an unpaired tail carrying Xbal restriction site. b Position of annealing refers to the uvrA gene sequence, with the first base of the translational initiation codon as +1.

Cordone et al. BMC Microbiology 2011 11:231   doi:10.1186/1471-2180-11-231

Open Data