Table 2

Primers used for PCR and qPCR

Name

Primer sequence (5'-3')


Primers for vectors construction


Rgg0182I1

CTGGAACTGCAGGAGCAGC

Rgg0182I2

ATAATTTGAGAATTCTGTACCTT

Rgg0182II1

TCTCTGGAATTCTTTAAATTG C

Rgg0182II2

CTTGTCCTGCAG TCTCACTCCC

Rgg0182SE1

CCCCCCCCATATGGGAAAACAAAATGAACTG

Rgg0182SE2

CCCCGGATCCTTAACCTACAATCGACTTAAA

Pep0182up

GAAGAATTCGTAAAAAGCATCAGATTTTAC

Pep0182down

AACTACTAGTGCATTTTAAGTCGATTGTAGG

SHP0182up

GAAGAATTCAACAATTTCATATGATTTCCTCC

SHP0182down

AACTACTAGTTCAGTCTCTCCTCTTTC

Primers for DNA EMSA


Pldh-5'

ACGCTTTCACTTAATAATTC

Pldh-3'

TGGTCTAAACATCTCCTTA

Pshp-5'

GTAAATACATGTCAATAGGAC

Pshp-3'

TTTGTTTTCCCATATATGCAACC

Ppep-5'

AGCATCAGATTTTACTCCAGATG

Ppep-3'

TTGTAGGTTAATCCCGTTTATGC

Primers for gene expression analysis


Gene

Locus

Forward

Reverse

ldh

stu1280

AAGCTATCCTTGACGATGAA

AATAGCAGGTTGACCGATAA

rgg0182

stu0182

GAAGTGGAGGAGTTGCCTAA

CCCAGCTCTCAATCCCAAA

hrcA

stu0118

ACACCTCTTCAAGGAACTGAT

GTCACTTCATCATCGGAGATA

dnaK

stu0120

GACATTGACGAAGTCATCCT

GCACCCATAGCAACTACTTC

dnaJ

stu0121

CGTGAAGTGACATGTAAGACA

ACCAAGTGGTGTTTGTGTATC

groES

stu0203

GAAGGTACCCGTACTCTTACTG

AACGTAATCTTCTCCGTCTTTA

groEL

stu0204

ATTGCTTATAATGCCGGTTA

AGCGTTAAATCCTGTACCAA

hsp33

stu0180

TTTAGTAGGTCCTTTCATG

CGATTTCACCAGAAATAAGC

cspA

stu0837

ATTGGTTTAACGCTGACAAAG

TAACCTTTTGACCTTCATCGT

cspB

stu0838

TATGGCAAATGGAACAGTAAA

CAAGTGATTTGAATCCATCAG

ctsR

stu0076

AGATCAGCTCAGCGAACA

AGAATACGCGAACGAATG

clpC

stu0077

ACTGGCAGATTATACCAAAGAC

CACCTACCAAGACAGGATTATT

clpP

stu0356

CTTGCTCAAGACTCGTAATAACT

AAGCCATATTCAAGTGTTTCTT

clpX

stu0581

TGGACTTATCCCTGAATTTATC

AAGACAAGAGGGTTTGATACTG

clpE

stu0602

CCGTACCAAGAACAATCCT

ACGGATAACTTGCTTGCTT

clpL

stu1614

CGTTTCGACGCAGTTATT

TTCGCTAACTGCCAAGTC


Restriction sites are indicated with bold letters: PstI: CTGCAG; EcoRI: GAATTC; SpeI: ACTAGT; NdeI: CATATG; BamHI: GGATCC

Henry et al. BMC Microbiology 2011 11:223   doi:10.1186/1471-2180-11-223

Open Data