Table 3

Primers used in this study

Designation

Sequence (5` - 3`)

Comment and reference


Primers for the mobilisation experiments

Cm_fw_PstI

CTGCAGGCTTGTCAGGGGGGCGGAG

cat cassette in pGP704

Cm_rev_PstI

CTGCAGACCCTGCCCTGAACCGACGA

"

pir_fw_SacI

TTTGAGCTCCCGTCAAGTCAGCGTAATGCTC

Introduction of a stop codon into pir

pir_revStop_ EcoRI

TTTGAATTCTCAAGCTTCATCATCTTTATCGCCAGA

"

paiII_1XhoI

TTTCTCGAGGGGAAGCACGATATGCAGCC

Labelling of PAI II536 by homologous recombination with pSG704

paiII_1SacI

TTGAGCTCGATATTTTTTGGCTGCTTCAGCTTTACG

"

paiII_2SacI

TTTGAGCTCGGACAAGAACACAAAATCACTCTACTGA

"

paiII_2XhoI

TTTCTCGAGCCCGGCTTCATCGACAATGA

"

ATT1

GAGGTACCAGCGCGGTTTGATC

Confirmation of pir integration into the λ attachment site (E. coli)

ATT2

CAGATGGCGCAATGCCATCTGG

"

17 kD up

CCCGGCTGAACAGACGATT

Screening PCRs for PAI II536

17 kD in

GCAGCGGAGAGTCATTGTC

"

hlyDup

CGCGATAATCCGCTACATC

"

hlyDin

GGGTATGGCTGTCACTGCA

"

hec_down1

CACACTGAAAGGCCGCAGC

"

hec_down2

GTACAGCGTGCCGTTCTGC

"

dsdXin

GCTGTATCCCGACATCAGC

"

dsdAup

GCCACATCATTCTCCCGTA

"

ORFAin

CATCCCCTTCACTACAGGA

"

Na-Anti_pdo

CAGCGATGCTGGACCGTAT

"

PaiII_1fw

CAACCGTAGAAATACGTGCCG

Overlapping PCRs of PAI II536

PaiII_1rev

CCAGTATGAGGCAAACCCTAAAG

"

PaiII_2fw

GACAATAGCTGTCCATACGGTG

"

PaiII_2rev

CAATGCTGGCCATATCCATCAG

"

PaiII_3fw

GACTCACTACTGGGAAGGTC

"

PaiII_3rev

GATGGTCATGTGCAGGGAGG

"

PaiII_4fw

GTGATGTCACTGGCGGTAATAATC

"

PaiII_4rev

GGCGATGACCATGATACGGTA

"

PaiII_5fw

CGGAATACTGAACTGCGGATAA

"

PaiII_5rev

GCTGGATGCCAATCAATGATCG

"

PaiII_6fw

GCATCCATCTCCGTTCACAG

"

PaiII_6rev

GCATGGCTGGTTGTTCCTAAAC

"

PaiII_7fw

CCTCCTTTGGACTGAAGTTCA

"

PaiII_7rev

GCACAGGCGCTCTTTTATTGTTTG

"

PaiII_8fw

GGACACATGGCAGGGTCTG

"

PaiII_8rev

GGAACACGTCTTCTTGTTGACA

"

PaiII_9fw

CAGCGATTTGTCACCACCTG

"

PaiII_9rev

GTACTTGACGCGGCGGACA

"

PaiII_10fw

GCTTCTGAAAAACGGGTGAAGTC

"

PaiII_10rev

CATGGCGCATCATGAAATCATCA

"

PaiII_11fw

CTCTCGCGTATATTCAGCAAAAAC

"

PaiII_11rev

CGTCACATCGGATAACATTCGG

"

PaiII_12fw

CTGATATCTCTTTCAGACTTCAGAAC

"

PaiII_12rev

GTCACCTCAAGAACGTCTAACC

"

PaiII_13fw

CTGGCACCTATGGATCAGGT

"

PaiII_13rev

GTTCAGCAACTGAAGGTTCATACT

"

PaiII_14fw

GATGACCATCAGTGTTTCCGCT

"

PaiII_14rev

CGGGGATTTAAGTATTGGTCAGTT

"

PaiII_15fw

GCAACAATCTGACCTGCAAGCAT

"

PaiII_15rev

GGATGATGAGCTTCAGGTTCAG

"

PaiII_16fw

TGCCGTACAGCTTGTCATTACC

"

PaiII_16rev

CTGGGTACTGCACTTTCCTCA

"

PaiII_17fw

CTGACATTGCCACCAGATTTTTGT

"

PaiII_17rev

GGTGTAATGCGCTAACCTGTTTC

"

PaiII_18fw

CTACAAATGTTCAATATGGTGGGTATATC

"

PaiII_18rev

CGCTGTTGCCACTGGATTAATG

"

PaiII_19fw

GCCATCCACTACATATCATGCC

"

PaiII_19rev

CGACGGGTTTCTATGCTGAG

"

PaiII_20fw

CCTCAACTGGAGCAATTTTCTGTC

"

PaiII_20rev

GGACTTGGATCACTGAAGCTTTAC

"

PaiII_21fw

CCACAAGCTGTTGATTTTGGTACG

"

PaiII_21rev

GCGATAGTGGGCAATTTGCTATTG

"

PaiII_22fw

CGTAAACGTCCTCCAGAATTTATATC

"

PaiII_22rev

GGACGATGGCGATATGTCTG

"

PaiII_23fw

GTTCTTCATTTCTACGTTGCTTTGTC

"

PaiII_23rev

CCTACCAGAGATAACCCATGG

"

PaiII_24fw

CGGTTTCTCCTGAACATAACTTTG

"

PaiII_24rev

GGTGAAGTCCGTAACCAGAATG

"

PaiII_25fw

GCCTGTTTTTGCTGCTGTTCAC

"

PaiII_25rev

GCAGGACTAAAGTTGCAGAGC

"

PaiII_26fw

CGCTTTCGCCCCGATTTCTA

"

PaiII_26rev

ATGACCGTCGTACTGTGGAC

"

PaiII_27fw

GTCAGCCCGCTTTTCTTCTG

"

PaiII_27rev

GCTCCGTCGTATACCGATGA

"

PaiII_28fw

CGGTCAAGAAAATACGATGAGCC

"

PaiII_28rev

GAACGACAGCAAAATCCTCTCC

"

PaiII_29fw

CAGCACCTGCGCCGTCA

"

PaiII_29rev

GCGATGCCACGGTGAAAACC

"

PaiII_30fw

CCGGTATTACTGAATGTCCCG

"

PaiII_30rev

GAACATGAAGACAGCACTGACC

"

PaiII_31fw

CCTGAAGCAGAACATCATCCAG

"

PaiII_31rev

CGGCTGATATCCTGAGACTG

"

PaiII_32fw

CTCGCTTCCACGGACGTTG

"

PaiII_32rev

GTTGGCAGTGCTGAAAGCAG

"

PaiII_33fw

GGTCAGAATGTCCTCAGTGAG

"

PaiII_33rev

CAATGAAATTGACAGGAGAGATACC

"

PaiII_34fw

CCACTGGCATGATTTTTACCCTG

"

PaiII_34rev

CGGGCACATTCCTGCTGTC

"

PaiII_35fw

GGATACTGGGCGATGAGCG

"

PaiII_35rev

GAGCACGGTGAGCGAAATAG

"

PaiII_36fw

CCGCATTAGGTGACTTTACACG

"

PaiII_36rev

GACGCCGTACTGACCGATG

"

PaiII_37fw

CCAGGTTTGTTATCGAGGTAAGG

"

PaiII_37rev

GGCGCTATCGACTACGTCC

"

PaiII_38fw

GGCAGTATATCGATTCGGCGA

"

PaiII_38rev

GCTTCCCAGCCTGTCACTTC

"

PaiII_39fw

GGGCATCTTCAAAGTCAAAGCC

"

PaiII_39rev

CGCCCGTCTGTTTTTCAGTTTC

"

PaiII_40fw

GGGGCATCAAGGTCGCTATTT

"

PaiII_40rev

CAGAACCGCAGCCAGCCAT

"

PaiII_41fw

GCTGCGATGCGGATCCAC

"

PaiII_41rev

GGTTACCGCAATGGTGAAAGG

"

PaiII_42fw

GCTTTTACTGCGCCGACATCA

"

PaiII_42rev

CGTTGCACGCGGCTATCTG

"

PaiII_43fw

CGATGGATACATTCGGGTTTAGC

"

PaiII_43rev

GCAACAGCGACATCATCCTG

"

PaiII_44fw

CTCTCTCTTCAGCCAGTCATC

"

PaiII_44rev

GCCAAAATCTGATCCCCAGC

"

PaiII_45fw

GCAACTACGCCATTGGTTTGTC

"

PaiII_45rev

GAAAAACTGGCACGTCATCAACG

"

PaiII_46fw

GAAGGCTGCCATTCGGGTATA

"

PaiII_46rev

CTGTACTGACTCGTCAGCACT

"

PaiII_47fw

CTTGAGATTCAGCAAGGTGGC

"

PaiII_47rev

GGAATCCCCTAATGCTGGTG

"

PaiII_48fw

GTATAACGGGATGAAAGTGGGG

"

PaiII_48rev

GTTGAGAATGTCGGGAATGGTAC

"

PaiII_49fw

GGATGTGTATCAGACAAAGCAATG

"

PaiII_49rev

TTTCTGGCGAATTTCTTCAGGAAG

"

PaiII_50fw

CAGCCATTTTTCCCTCTCCG

"

PaiII_50rev

CCTGACCATCTTCCGTCATG

"

PaiII_51fw

CTGCTGTTCACTGTGGCATC

"

PaiII_51rev

GAGTGGCAACCAGTTGAGACT

"

PaiII_52fw

CGCATAATTCCACCACACCTTC

"

PaiII_52rev

GGCTGGTCGGTACGCAC

"

PaiII_53fw

GGCAGGCATTTCACTGTGTGA

"

PaiII_53rev

CGAAGGCCGGACTCGAACA

"

K12R (rev)

ATCCTGCGCACCAATCAACAA

E. coli K-12 specific [67]

K12L (fw)

TTCCCACGGACATGAAGACTACA

"

K12IS-L (fw)

CGCGATGGAAGATGCTCTGTA

"

orf4bico

GGAATGAATGCCACTCCATTATTGACAGAAATG

E. coli 536 (K15 capsule)- specific

orf5bico

GATCAAACGAGTCAGCTAAATAATCCCCAC

E. coli 536 (K15 capsule)- specific

M803b

GCCTGGAGTGTGACAAAGGTTAC

leuX flanking primers [17]

M805c

GATGTTCACCAAGGTGGGCGT

"

leu 2

ACCAAGCGCTGCAAAAAGAT

Concatemer PAI II536

Concat 1

CCGGATTGGATCTATCGCGA

"

yjgB1

ACTTTATCGGCACCCATCG

Downstream of leuX

yjgB2

GCATGAGGTGATTGGGCG

"


Schneider et al. BMC Microbiology 2011 11:210   doi:10.1186/1471-2180-11-210

Open Data