Table 2

Primers used in this study

Primer

Sequence


P1

TAACCTAAAAAAACAACATAATTTATTTTATATTTGGAGAAAAAGATATGATTCCGGGGATCCGTCGACC


P2

GTATATATGGCACATATAAATTATGTGTTTTATAATCTACCTTTATTGAATGTAGGCTGGAGCTGCTTCG


P3

CGGTCACGATGGTTCAATGTCT


P4

AGCGTTTGACATCATCACCATACT


P5

TGCCTACAGCTCAAGTCACGTAA


P6

CCACTCGAAAGCGAAACTTGT


P7

CATCTCGAGCGCCACACTATCCAC


P8

CACTCTAGATTATAATCTACCTTT


P9

GGCTTAATTGCAGTCGCAGTTGCT


P10

GTGCAGCTTTACCTACTCCTCCTT


P11

ACTCCGCAGCTGATGCAATGAAAG


P12

CAAGCTTATCGATACCGTCGACCT


Janowicz et al. BMC Microbiology 2011 11:208   doi:10.1186/1471-2180-11-208

Open Data