Table 2

Primers used in this study

Primer

Sequence (5'-3')


HAEscU

CCG

    CTCGAG
TACCCATACGATGTTCCAGATTACGCTATGAGTGAAAAAACAGAAAAGCCC

EscURevBglII

GA

    AGATCT
ATAATCAAGGTCTATCGCAATACG

JT1

CC

    GAGCTC
GTTACAGGATCAAACATTGCC

JT2

GC

    GCTAGC
TTCACTCATTAATCATGCTCGG

JT3

CC

    GCTAGC
CTTGATTATTAATCGATAATTTGC

JT4

GCCTCGTGGGCAATATCATTGCG

JT7

CCAAATGCAGTAGAACTCAGAAGGC

JT8

GG

    GGATCC
CTGACATAATTGATAGATCGTTACCG

JT10

ACAT

    GCATGC
TCAGTGGTGGTGGTGGTGGT

JT12

/PHOS/GTTATTGTTAAAGCCCCGACTCACATT

JT13

/PHOS/GTTTGATTTTTTGATGTTATTCGC

JT14

/PHOS/GTTAAAAACGCGACTCACATTGCG

JT15

/PHOS/AATAACGGTTGATTTTTTGATGTTATT

NT278

NT279

NT281

NT282

AA

    GGCGCC
TTTTTAACAATAACGGTTGA

AA

    GGCGCC
GACTCACATTGCGATTTGCCTA

GCGACTCACATTGCGATTTGCCTA

GTTTTTAACAATAACGGTTGATT

XH1

CC

    ATTAAT
ATGTCTACAGGAGCATTAGG

XH2

CG

    GAATTC
TCAACGAAACGTACTGGTCC


/PHOS/indicated primers that are 5' phosphorylated, restriction sites have been underlined.

Thomassin et al. BMC Microbiology 2011 11:205   doi:10.1186/1471-2180-11-205

Open Data