Table 4

Primers developed in this study for the specific identification of C.jejuni and C. coli.

Target Gene

Primer Name

Sequence (5'-3')

Tm (°C)

G+C Content (%)

Product Size (bp)


glyA

F-JK

TGGCGGACATTTAACTCATGGTGC

59.6

50

264

R-JK

CCTGCCACAACAAGACCTGCAATA

59.5

50

ask

F-JK

GGCTCCTTTAATGGCCGCAAGATT

59.8

50

306

R-JK

AGACTATCGTCGCGTGATTTAGCG

58.5

50


Zhou et al. BMC Microbiology 2011 11:175   doi:10.1186/1471-2180-11-175

Open Data