Table 2

Primers used in the MLVA scheme

Forward primers

Sequence (5'-3')

Coordinates1

Ref strains2

Reverse primers

Sequence (5'-3')

Coordinates1


SAG2F

TCTTCCAAGTGGTGTCAACG

76270 - 76289

A909

SAG2R

CAACGTTTGGAGTTGCTTCA

76494 - 76513

SAG3F

CAAAAACGTGCTGCCTATGA

107351 - 107370

A909

SAG3R

CATCCCTCCTCCACCAAAA

107458 - 107476

SAG4F

GGTCAGTTTTTATTTATCGTAAGC

152991 - 153014

A909

SAG4R

AGTCTTGCGAAGGCAGACAC

153085 - 153104

SAG7F

TGGTGTTGATAAAGTTGATGTTCC

745963 - 745986

A909

SAG7R

GCCATATGAACTGCGGAAAC

746228 - 746247

SAG7bisF

ACCTATGCTCCCAGTGGTTC

111555 - 111574

NEM316

SAG7bisR

TCACTTAAGCGCACTGCAAC

112036 - 112055

SAG21F

TGAAAGAAGTGGATTTTTCCCTA

1062584 - 1062606

A909

SAG21R

AAAATAGGTTTTAGAACTTGGAAATCA

1062675 - 1062701

SAG22F

TGTAACACTAGCTCCAATTTGTTTT

1745819 - 1745843

A909

SAG22R

TCGGTCTTGTCTCAGCAATG

1746727 - 1746746


1, Nucleotide coordinates in the reference strains (A909, NEM316) chosen for primer design

2, Reference strain chosen for primer design

Haguenoer et al. BMC Microbiology 2011 11:171   doi:10.1186/1471-2180-11-171

Open Data