Table 2

Oligonucleotides used in these work

Name

Sequence


ALFAU2

5'-AGGGTACCCCGCAAAAGAAAAGA

Mal-C2Kpn

5'-TCGGTACCTTACCCAGCCCTCAAACC

RBS-C

5'-GGATCCAAGGAAACAGCTATGCAGTCGGGGAATG

repC-F1U

5'-GCGGCCGCGGATCCAATGCAGTCGGGGAATGTA

repC-F1L

5'-ACTAGTCCCGGGAACCCCGACTCCACCAGA

repC-F2U

5'-GCGGCCGCGGATCCAATGGATCGTCCGTAAGGATAG

repC-F2L

5'-ACTAGTCCCGGGGCGCGGAATTCTGCTCGC

repC-F3U

5'-GCGGCCGCGGATCCAATGGTTCCGACCCTTGAAGGG

repC-F3L

5'-ACTAGTCCCGGGGCGCGGTGCATAGTCGCT

repC-F4U

5'-GCGGCCGCGGATCCAATGGGCGTGGGAAGCTGGCGA

repC-F4L

5'-ACTAGTCCCGGGTTACCCAGCCCTCAAACC

repC-D1U

5'-GGATCCAAGGAAACAGCTATGACGCTTGCGCTCGTGC

repC-D1L

5'-GCCAAGCTTTTATATCATCGGGCCAAGC

repC-D2U

5'-GGATCCAAGGAAACAGCTATGGGAAAAGCTGCCGATA

repC-D2L

5'-GCCAAGCTTTTATAGATCCCGCAGATAG

repC-D3U

5'-GGATCCAAGGAAACAGCTATGGAACTGCTCAAGA

repC-D3L

5'-GCCAAGCTTTTATTCCAGGATGCACGCA

repCd-sSDU

5'-GAAAAGAGCTCCCTCAACGT

Cd-StopC-U

5'-GGATCCTAACAGTCGGGGAATG

Ttrack1-U

5'AGCCCGAGTCCGTGAACGAGTCCGAGCCGCGCTCCGAGAAG

GAGCAGCACATACAGAATTCAAAACCC

Ttrack1-L

5'-CTCGAGGTTCTCCAAGCGGTTCAGCACCTCCTCGCGGAG

CATCTCCATCTCGTTGAGCACGCTAGTGACCCCTTCAAG

Ttrack2-U

5'-ATCGAGCAGCACATCCAGAACTCCAAGCCCGAGTCCGTG

Ttrack2-L

5'-GGAGTTCTGGATGTGCTGCTCGATGTGGGCGGCGTTGGT

GCTGATCTTCTCGGCGTTCTCGAGGTTCTCCAAGCGGTT

repCATBamU

5'-GGATCCAAGGAAACAGCTATGGACAGCACATGTGTAACG

repCATHindL

5'-AAGCTTCTAACCCGCCATGCCCACCTC

K-Syma-L

5'-GGTACCTCACGACACCCCCCGCCC

C-SymA

5'-GGATCCAAGGAAACAGCTATGGAGATTGGAAGTGTGACG

Mal-C2

5'-TCAAGCTTTTACCCAGCCCTCAAACC

AL-2U

5'-ATCGGCACAGCGTTCGGCTTTTCGTCGCCCCTC CTGGCGCGATCGGAA

1L-BU

5'-GAGAATGCTTTTGGCTTCGACCTGCTCGCACCAC TGCTGGCCCGCTCC

2L-CU

    5
'-GAGCAGGGGGCAAAGGCGAGCTTGGAACCGGCC AACAAGGCAAAAAGG

BL-3U

5'-GAGCGGTTAGACGGCCAAGCCATTAGCCTTCAGC CGAAGAATGAATCG

AL-2Uc

5'-CGAAAAGCCGAACGCTGTGCCGAT

1L-BUc

5'-CAGGTCGAAGCCAAAAGCATTCTC

2L-CUc

5'-CAAGCTCGGCTTTGCCCCCTGCTC

BL-3Uc

5'-AATGGCTTGGCCGTCTAACCGCTC

Cd-1086L

5'-GTTGATGAAGTTAGCCCTTTCCAG

SaU-CdL

5'-AACGCCAAGCATAGATCGTACCGT CCCCAGCATAGATCGAACCACCAC

SaL-CdU

5'-CTGTTGAGCTTCTATCCGGAGAAC GAGTTGCGTCAGGATGCACAATTG

Cs-1087U

5'-CTGGAAAGGGCTAACTTCATCAA CTCTGCTGGCGGCTATCTGCGCGAT


Cervantes-Rivera et al. BMC Microbiology 2011 11:158   doi:10.1186/1471-2180-11-158

Open Data