Table 2

Oligonucleotide primers

Target gene

GenBank accession no.

Primer*

Primer sequence

Location


Oligonucleotide primers used for RT real-time PCR

gyrB

57636585

gyrB-F

CTTATATGAGAATCCATCTGTAGG

1110-1263

gyrB-R

AGAACAATCTGCCAATTTACC

lrgA

57636056

lrgA-F

TGGACTTGTACTATTATTTATCGC

165-309

lrgA-R

AAGGATTGGTAAAGAGTTAATGAC

lytS

57636054

lytS-F

CTGTTCAAGATAATGGTCAAGG

1535-1680

lytS-R

CAGTGCCGATGTTGTTCC

serp0043

57636640

serp0043-F

CAAGCACAAGCGTCTTCATC

73-236

serp0043-R

ACTCTTTCACCATTATTTGTTTCAG

glpQ

57637130

glpQ-F

CCGTTACACTGGGTTTAGC

41-221

glpQ-R

TTACCACTTACTGAGTCTGATTC

arlR

57636010

arlR-F

AGAGAATGATGGAAAGGCAGGT

90-253

arlR-R

ATGTCTCGCTTTTCGCAGTAAT

atlE

57637180

atlE-F

AACAACCACAGAATCAGTCTAATC

92-237

atlE-R

TTGAACTTGGGTAGGGTCTTG

aae

57637180

aae-F

AACAAATTGATAAAGCAACG

1970-2186

aae-R

GTTGTCTTTCCTTTAGTGTC

aap

57636451

aap-F

AATAGAACCTACAACTTCAGAACC

945-1039

aap-R

TGTTATTGGATGAACTATCAGCAG

icaA

57636387

icaA-F

GGTTGTATCAAGCGAAGTC

556-754

icaA-R

ACATCCAGCATAGAGCAC

saeS

57636974

saeS-F

GGTATCGTTCCAGAACTTCAATC

757-881

saeS-R

ATTTGTTGTGCTAACTCATTTGC

saeR

57636975

saeR-F

CTCAAGAACATGACACGATATACG

245-354

saeR-R

TCTAGCGAGAAGGTTATTAGTACG

saeQ

57636990

saeQ-F

GCAAGTTTCTTTGGAGCCTTC

268-447

saeQ-R

CTTATCTTCACCTCGGTTATTACG

saeP

57636991

saeP-F

CTAACTCGGAAAGCGATCAC

71-258

saeP-R

GTCTGGACCTTTAGAAGATTTG

Oligonucleotide primers used for eDNA quantification

gyrA

57636584

gyrA-F

CCTTATGAAACTCGGAGATGG

2382-2489

gyrA-R

TCAGTAGTAGTAGATTGTTGCG

lysA

57637514

lysA-F

TGACAATGGGAGGTACAAGC

32-107

lysA-R

TGGTCTTCATCGTAAACAATCG

serp0306

57636873

serp0306-F

ATGCCACATCCACGAAAGA

203-381

serp0306-R

TGTAACTGACAATGCCCAATC

leuA

57638228

leuA-F

GTGAACGGTATTGGTGAAAGAG

685-762

leuA-R

GTGGTCCTTCCTTACATATAAAGC


F, forward primer; R, reverse primer

Lou et al. BMC Microbiology 2011 11:146   doi:10.1186/1471-2180-11-146

Open Data