Table 1

Melt-MAMA primers targeting informative canSNPs

SNP

SCHU S4 position

Genome SNP state (D/A)a

Melt MAMA primerc

Melt-MAMA primer sequencesd

Primer conc. (μM)

Annealing temp. (°C)

Melting Tm (°C)


B.Br.026

1484645

A/C

D

GAAACTTATTTGTTCCTAAGACAGTGACAcTA

0.800

55

73.1

A

ggggcggggcggggcAAACTTATTTGTTCCTAAGACAGTGACAgTC

0.200

79.7

C

GCATTGAGTTTGACAGGGTTGC

0.200


B.Br.027

1329722

T/Gb

D

ggggcggggcggggcggggcCATGCCAGGCACTACAATTGATAGTaTA

0.200

55

78.2

A

TGCCAGGCACTACAATTGATAGTtTC

1.000

73.6

C

TATACTTCTGACCATGGCGTTCAAAT

0.200


B.Br.028

212729

T/G

D

ggggcggggcggggcggggcAAATTAGTTCAAATGTTAAATTTGATcCT

0.200

55

75.8

A

AAATTAGTTCAAATGTTAAATTTGATaCG

0.200

67.7

C

CAAAATAAATCCCGTTGAGAATAGAA

0.200


B.Br.029

1185519

A/G

D

ggggcggggcggggcggggcTGCTTAATCTCATTGACTAGCTGTGgTA

0.200

55

78

A

TGCTTAATCTCATTGACTAGCTGTGaTG

1.000

70

C

ACAAAGTTGAAACTATCGAGCATAAATC

0.200


B.Br.030

928335

T/G

D

ggggcggggcggggcggggcTGTTGGGTCAAAGAGAGAAGTgTT

0.200

55

78.2

A

ATTGTTGGGTCAAAGAGAGAAGTaTG

0.200

70

C

GCCACCAAAGAATACAGAGTAGTCAT

0.200


B.Br.031

1634565

A/G

D

ggggcggggcggggcggggcGCACCAATCGTATCTAATTGATcCA

0.400

55

79

A

GCACCAATCGTATCTAATTGATtCG

0.200

70

C

AACTTTGCTAAAACAAATGCTGTTGC

0.200


B.Br.032

283540

A/Gb

D

ggggcggggcggggcggggcTGCTAAACCTACAGTAATCAGAAGTATtAT

0.200

55

72

A

TGCTAAACCTACAGTAATCAGAAGTATcAC

0.600

68.4

C

GCTAAATTTTAGTAAGATAAAAAGTGTAAGTAGTG

0.200


aSNP states are presented according to their orientation in the SCHU S4 reference genome (NC_006570);

bAssays designed from the reverse complement of the reference sequence.

cD: Derived; A: Ancestral; C: Common Primer

dPrimer tails and antepenultimate mismatch bases are in lower case

Chanturia et al. BMC Microbiology 2011 11:139   doi:10.1186/1471-2180-11-139

Open Data