Table 2

Primers used to determine CTX prophage array structure

Primer

Nucleotide sequence (5' to 3')

Position (GenBank Accession no. NC_002505-6)


tlcF

CCAAAACAACAGAAGCAACAGAGCAACG

1574460-1574487

rstCF

GGCGCTTATACAGACGAAATCGCTC

1564180-1564201

rstCR

AGCGCCTGAACGCAGATATAAA

1564290-1564311

rstAR

CGACAAAAACAAACGGAGAAGCGT

1572748-1572771

ctxAF

CTCAGACGGGATTTGTTAGGCACG

1567895-1567918

rtxR

CAAGCTGCGATCAGCATGGCGTGGTC

1563652-1563671

cepR

CAGTGTTTTGGTGACTTCCGT

1571101-1571121

chr2F

CTCACGCTGAACAGCAAGTC

507564-507583

chr2R

AAACCGGGAGAAGTGATTGC

509487-509506


Ceccarelli et al. BMC Microbiology 2011 11:130   doi:10.1186/1471-2180-11-130

Open Data