Table 5

PCR primers and probes used in the species-specific real-time PCR assays

Primer or Probea

Nucleotide sequence 5'-3'

Location within target

Origin

Target Gene detectedb


glyA-F forward

F: AAACCAAAGCTTATCGTGTGC

297-320

This study

glyA-R reverse

R: AGTGCAGCAATGTGTGCAATG

422-359

Lagier et al. (2004)

Campylobacter coli glyA gene (125 bp)

glyA-P MGB Probe

P: FAM-CAACTTCATCCGCAAT

346-330

This study


hipO-F forward

F: CTTGCGGTCATGCTGGACATAC

340-360

This study

hipO-R reverse

R: AGCACCACCCAAACCCTCTTCA

464-444

This study

Campylobacter jejuni hipO gene (124 bp)

hipO-P MGB Probe

P: VIC-ATTGCTTGCTGCAAAGT

424-409

This study


bp, length in base pairs of the species specific PCR products

aPrimers and probes were designed by using the program Primer Express version 2.0 (Applied Biosystems, Foster city, CA, USA). The TaqMan® MGB probes were dual-labelled with either fluorescent reporter dyes FAM (6-carboxyfluorescein, C. coli specific probe) or VIC (C. jejuni specific probe) on the 5'end, and quenched by a non fluorescent quencher associated with a minor groove binder at the 3'end (Applied Biosystems).

bThe nucleotide sequences were retrieved from the GenBank™ sequence database http://www.ncbi.nlm.nih.gov/Genbank/index.html webcite under accession numbers: [GenBank: Z36940] for C. jejuni hipO gene and [GenBank: AF136494] for C. coli glyA gene.

Leblanc-Maridor et al. BMC Microbiology 2011 11:113   doi:10.1186/1471-2180-11-113

Open Data