Table 2

Primers used in Real time quantitative PCR

Gene

Primer pair

Primer sequence


sigA

SIGAF

ATCTGCTGGAAGCCAACCT

SIGAR

GATCACCTCGACCATGTGC


impA

IMPAF:

CGATCTCGTCTTCGTCGC

IMPAR:

CCCTATGCTGCCAAGAATCTC


suhB

IMPBF:

GCGAGAAGCAGGCAGAATT

IMPBR:

CTCTCGGCGTTGACAACAA


impC

IMPCF:

GCTGCTTGAAGATGGCGTC

IMPCR:

CCACCAGGCAGTAAGACAGAA


cysQ

CYSQF:

ATCTGACGGACGACCTGACT

CYSQR:

CCAACGGGTCAATAATCCAC


Movahedzadeh et al. BMC Microbiology 2010 10:50   doi:10.1186/1471-2180-10-50

Open Data