Table 2

qRT-PCR primers

GAPDH

S: ATTGGGCGTATTGTCTTCC

AS: TTGAGCATGTAGGCAGCATA

MAT1-1-1

S: TTCGTTCATAGCCTTCAGAAGCTTC

AS: GGCCAGCATGACTGTCACGAAT

PPG1

S: CTGTGTGGGCAGTAGCAATTCC

AS: CAACGTTTCGCGACGAATTCA

STE2

S: TGCTCTCGTTACTCGCAGAC

AS: ATTGGATTATTGAGAAAATGGCTGGAATC

STE3

S: ACAATCGGTATATAACCAATACACAGTAG

AS: GTTGTCCAGCACCGTCGATA

BEM1

S: TGGAAGAAGATGACGGCGGAAT

AS: TGTGGCTTTGTTGTAGGTGAGGG

HMK1

S: CGTGGCAGCACAGACAATGC

AS: GGCGGATTTGCAAGGACGT

PKC1

S: CCGAAAGTCGTCACCAAGTG

AS: CATGTAAGACTGCATTCTGAGC


Laskowski and Smulian BMC Microbiology 2010 10:49   doi:10.1186/1471-2180-10-49

Open Data