Table 1

List of bacterial strains, plasmids and oligonucleotides

strain, plasmid or oligonucleotide

relevant characteristics or sequence

source or reference


E. coli strains

DH5α

F- thi-1 endA1 hsdR17(r- m-) supE44 ΔlacU169 (ϕ80lacZΔM15) recA1 gyrA96 relA1

[32]

Corynebacterium strains

C. glutamicum

ATCC 130302

ATCC [61]

::dld

dld inactivation mutant of ATCC 13032

This work

C. efficiens

DSM44547

DSM

Plasmids

pEKEx3

SpecR; Ptac, lacIq

[24]

pEKEx3-dld

pEKEx3 containing dld from C. glutamicum and an artificial ribosome binding site

this work

pVWEx1

KanR; Ptac, lacIq

[34]

pVWEx1-dld

pEKEx3 containing dld from C. glutamicum and an artificial ribosome binding site

This work

pK18mob

KanR; integration vector for C. glutamicum

[62]

pK18mob-dld

pK18mob carrying an internal fragment of dld

This work

Oligonucleotides

sequence

underlined nucleotide

(position in NC003450)

rbs-ndld

GTCGACAAGGAGATATAGAT

    A
TGACGCAACCAGGACAGAC SalI

955683

cdld

GGAGCTC

    T
TAGGCCCAGTCCTTGTGC SacI

957398

Ex-dld-fw

GCCCTGCAGGAAGGAGATATAGAT

    A
TGACGCAACCAGGACAGAC SbfI

955683

Ex-dld-bw

GCGGTACC

    T
TAGGCCCAGTCCTTGTGC KpnI

957398

dld1

AATCAT

    A
TGAGACGCAACCAGGACAGACCACC NdeI

955683

dld2

AATGGATCC

    G
GCCCAGTCCTTGTGCGGCGACGTGC BamHI

957398

Cg-dld-SalI-N498

AAGTCGACAGCCAGATTCCAGATTCGCAAGGGT SalI

956907

Cg-dld-C1716-SalI

GGTCGAC

    T
TAGGCCCAGTCCTTGTGC SalI

955683


Kato et al. BMC Microbiology 2010 10:321   doi:10.1186/1471-2180-10-321

Open Data