Table 3

Primer and probe sets for each serotype used in quantitative PCR

Toxin Class

Sequence

    Location on Toxin Gene(bp)


BoNT A Forward

TGGTTTTGAGGAGTCACTTGAA

582

BoNT A Reverse

TCATGTCCCCCAAATGTTCT

809

BoNT A Probe

TGCAGGCAAATTTGCTACAGATCCA

627

BoNT B Forward

CAAGAAAACAAAGGCGCAAG

619

BoNT B Reverse

CTGGGATCTTGYCCTCCAAA

833

BoNT B Probe

CGTGGATATTTTTCAGATCCAGCCTTG

652

BoNT C Forward

CAACTTTAATTATTCAGATCCTGTTGA

18

BoNT C Reverse

GGCTTGTAACTCGAGGAGGTT

199

BoNT C Probe

TGAGCCTGAAAAAGCCTTTCGCA

93

BoNT D Forward

CCATCATTTGAAGGGTTTGG

541

BoNT D Reverse

TGGGTCCATCTTGAGARAAA

791

BoNT D Probe

GATTCGTCCACAAGTTAGCGAGGGA

744

BoNT E Forward

ATAATGGGAGCAGAGCCTGA

448

BoNT E Reverse

CCCTTTAGCCCCATATAGTCC

678

BoNT E Probe

TGCCAAGCAATCACGGTTTTGG

515

BoNT F Forward

GTSAGACAATACCTCAAATATCAAATCG

1488

BoNT F Reverse

CTGGYACTTTTTGTGCATGT

1646

BoNT F Probe

TGCCAAGATATGATTCTAATGGAA

1551

BoNT G Forward

ATCCAACCTGGAGCTGAAGA

427

BoNT G Reverse

GCTGGATCTGCAAAATACGC

674

BoNT G Probe

TGGCCATTCCCCAATATCAGAAGG

534


Y = C or T

R = A or G

S = G or C

Indicated in this table are the type specific primers and probes for each BoNT tested in this manuscript. Included are forward, reverse and probe sequences and their locations within the toxin gene. Bases indicated in bold represent degenerate bases: Y represents C or T; S represents C or G, and R represents A or G.

Hill et al. BMC Microbiology 2010 10:267   doi:10.1186/1471-2180-10-267

Open Data