Table 2

Specific PCRs for identification of plasmid and chromosomally inherited α-hly determinants

DNA-target (position in sequence)

GenBank Accession

Primer

nucleotide sequence (5' - 3')

Tm (°C)

PCR product bp


hlyA (1915-1936) (2560-2580)

FM180012

10f

10r

GCTGCAAATAAATTGCACTCAG

CCCTGCACCGATATTATCAAG

53.1

666

"pHly152" (953-974) &hlyC (1612-1630)

FM180012

1f

1r

GTAGTTCAAAAGACAACTCGTG

ATCCCCGAAAGGAGCAATC

50.6

678

hlyR (597-618) & "pHly152" (1246-1267)

FM180012

32f

32r

GTCTTGCCGTACAATAATTTCC

TCCGTTTAATGTCATAACTCGC

56.5

671a

hlyR (167-188) (830-851)

FM180012

44f

44

ATTCCAAGCGAAGTCCATCCCC

CATAAAGCATGATGCCACCACG

66.5

685a

hlyA (3817-3839) (4497-4518)

FM180012

111f

111r

GATGGCACAAAAGCAACCGAAG

TTCTCGCTTGAAGGCCACATCC

55.4

702

hlyA (3865-3883) (4592-4613)

FM180012

113f

113r

CTTGGTGGCGATGTTAAGG

GACTCTTTTTCAAACCAGTTCC

53.5

749

hlyD (8297-8319) & IS911 (8925-8946)

FM180012

99f

99r

GCAGAATGCCATCATTAAAGTG

CCATGTAGCTCAAGTATCTGAC

53.8

650

PAI I (536) (44506-44524) &hlyC (45278-45299)

AJ488511

81f

81r

CCTGTGACACTTCTCTTGC

CCCAAGAACCTCTAATGGATTG

52.3

773a

PAI II (536) (31974-31995) &hlyC (32650-32668)

AJ494981

72f

72r

CCCAACTACAATATGCAACAGG

CGCCAATAGAGTTGCCTTC

51.9

695


a) PCR products of different lengths were obtained with these primers depending on the DNA template (see Table 1)

Burgos and Beutin BMC Microbiology 2010 10:193   doi:10.1186/1471-2180-10-193

Open Data