Table 3

Primers used in this study

Primer

Description

Sequence (5'-3')


Type 3 fimbriae deletion primers

1293

50 bp overhang mrk knockout F-primer 1

TCTTCTCTCTGCAGCAATGGCAACCGCGTTTTTTGGCATGACTGCTGCCCGTGTAGGCTGGAGCTGCTTCG

1294

50 bp overhang mrk knockout R-primer 1

GGTGTGAGCGGGATAGTTGTCTGAGTCACAGGCAGTTTCCTCTTCACCAGCATATGAATATCCTCCTTAG

1295

Knockout screening F 1

GGCAGCATAACCGAACAAAT

1296

Knockout screening R 1

TAAATTTTCTGCGGCAAACC

1456

50 bp overhang mrk knockout F-primer 2

GTTAACGGTACCCGCTTTATTTATCCAGGAAATGAAAAAGAAATAACGGTGTGTAGGCTGGAGCTGCTTCG

1457

50 bp overhang mrk knockout R-primer 2

CCTTTGTCCCAGAACTCCGGGCTGACATAGTTTTTCAGGCGTTGATCTTCCATATGAATATCCTCCTTAG

1463

Knockout screening R 2

GGTCTGGTTGCTGTTCCAGT

1458

50 bp overhang mrk knockout F-primer 3

GAGAGCTGCACCGTTATTTCTTTTTCATTTCCTGGATAAATAAAGCGGGTGTGTAGGCTGGAGCTGCTTCG

1459

50 bp overhang mrk knockout R-primer 3

CTTTACCGGCGGTGATTTTCAGGTCGTAGCGCCCTTTCCATTCGCCGTTGCATATGAATATCCTCCTTAG

1464

Knockout screening F 3

CTGCCGAGCTTAATACGCA

1465

Knockout screening R 3

GCAACGCCTTTATCCCAGA

1460

50 bp overhang mrk knockout F-primer 4

CTGCCGTTCAGGACGGCGCGCGCTTCACTTACTACGTTGGCTACGCTACCGTGTAGGCTGGAGCTGCTTCG

1461

50 bp overhang mrk knockout R-primer 4

GTGTAGCAGACGCCCATTTTGCCGTCTTTTCCACGGGTGATATTCAGGTCCATATGAATATCCTCCTTAG

1466

Knockout screening F 4

ATCCAGCTGGTTCTGTCCAC

1467

Knockout screening R 4

CCGGGCTGACAAAATTCTTA

1462

50 bp overhang mrk knockout F-primer 5

GGCTGGATAACGGTAATGCTGACGCAACGCCGGATACTATTACGACTCCAGTGTAGGCTGGAGCTGCTTCG

1468

Knockout screening F 5

AAAAGAAATAACGGTGCAGCTC

Inverse PCR primers

1450

mrkA R-primer A

CTTTACCGAAGAAATTAACC

1451

mrkA R-primer C

GAAGAAATTAACCTGACCGCC

1452

mrkD F-primer A

AAACCTATCTGAGCGCCAAC

1453

mrkD F-primer B

CCTCTTATGACTGGGAGAACG

1454

mrkD F-primer C

TGCGCGCTTCTATCAATATG

1455

mrkD F-primer D

GGCGTCCAGGTACTGAAAGA

Outside mrk cluster screening primers

1469

F-primer (outside mrkA of K. pneumoniae MGH78578)

TGGCGGTACATACTTCACTCA

1470

R-primer (outside mrkF of K. pneumoniae MGH78578)

ATCCTCTGCCTATTGTCTGACT

1471

F-primer (mrkE of K. pneumoniae pIA565)

TTTGCATATCCGCAATCTGA

1472

F-primer (outside mrkA of C. koseri ATCC BAA-895)

AATTGCAGGAACAGGGTCTG

1473

R-primer (outside mrkF of C. koseri ATCC BAA-895)

TTCCTTTCCCGTAACCA

1474

F-primer (outside mrkA of E. coli MS2027)

AGCGTTCTGCATGGCTTTAT

1475

R-primer (outside mrkF of E. coli MS2027)

AACGACGTTGGGTCGTTAGT

pMAS2027 screening primers

1476

pMAS2027 screening primer F1

GCGCAGAACTGGTTATGAAT

1477

pMAS2027 screening primer R1

TCATGGATTTTCTTCCTTAACAA

1478

pMAS2027 screening primer F2

ACAACTATCCCGCTCACACC

1479

pMAS2027 screening primer R2

ACCGTTAACGCGTAGTCACC

1480

pMAS2027 screening primer F3

TGCTTCAGCAGCATATCAGG

1481

pMAS2027 screening primer R3

GGAAAGCGTTAAAGCAGGTG

1482

pMAS2027 screening primer F4

CCGTATGCGCTTTTTCAAGT

1483

pMAS2027 screening primer R4

AAAGTTGAAGCCCGCTTTCT

1484

pMAS2027 screening primer F5

ACGGGTAAGACCGCTAACCT

1485

pMAS2027 screening primer R5

TCGATAAGGTAGGCATCAACAA


Ong et al. BMC Microbiology 2010 10:183   doi:10.1186/1471-2180-10-183

Open Data