Table 4

Oligonucleotide primers used in this study.

Primer

Sequence

Commenta


Bfp1_F

CAGCAGCATATGGACGAAGAAATCATTATTTTGATTAAT

E, L

Bfp1_R

CAGCAGGGATCCTTACCACAAAATTTCAGTTCCC

E, L

Bfp2_F

CAGCAGCATATGACAAGAAGAGTTGATTCTGCCAG

E

Bfp2_R

CAGCAGGGATCCTTATTTATTAGGTGACACTTTAAT

E

Bfp3_F

CAGCAGGGATCCAGAAGATAATGTAATTGCTTCTTT

E

Bfp3_R

CAGCCAGGAATTCTCATCGGTGTATATTGGTTATC

E

Bfp4_F

CAGCAGGGATCCGAAGACAATTTAGAATCTTTAA

E, L

Bfp4_R

CAGCAGGGATCCTCATCGCGATATAATAGAATATTC

E

Bfi1A_F

CAGCAGGAATTCGAGGATGTAATGGCTATTATG

E, L

Bfi1A_R

CAGCAGGGATCCTTACCTTCCAATATAAATGTC

E

Bfi1B_F

CAGCAGGGATCCACACCAACCAGATACTCCACC

E

Bfi1B_R

CAGCAGGAATTCTTACTCTTTTTTTTCGGCTGTG

E, L

Bfi4_F

CAGCAGGAATTCAGGGATGGAGATTGGGATTC

E

Bfi4_R

CAGCAGGGATCCTTAATTATCCTTTCCCTTTTGTTT

E, L

Bfgi2_Int_F

CCTGATATTAGCTTCTCTATCTTTTTTGCC

I

Bfgi2_Int_R

CAGCAGGGATTCCGAAGATAATGTAATTGCTTC

I

Bfgi2_attB_F

CCGGGAATGTTTCGTCAGGAATTGATGGTG

I

Bfgi2_attB_R

GGTTTATTGATTGTTATTTGTCGGCAAAG

I


a Primer used in E = Expression studies, L = Linkage studies, I = Integration/Excision studies

Thornton et al. BMC Microbiology 2010 10:122   doi:10.1186/1471-2180-10-122

Open Data