Table 4

Primers used for quantitative-PCR

Primera

Sequence 5' to 3'


QPCR-16s-F

TCGTCAGCAAGAAAGCAAGCT


QPCR-16s-R

GCTGGCGGCAGGCTTAA


QPCR-adhC-F

CTGCTGAATGTGGCGAATGT


QPCR-adhC-R

CTGACCATCTGGCATTAAGC


QPCR-hxuC-F

CGAGGGTTAAGTGATAATCGTGTT


QPCR-hxuC-R

AGCTACTTGGTCCTTTGATTACTTCAATT


QPCR-fhuA-F

CCGTCGTTTCGGTGATAACAA


QPCR-fhuA-R

TCGTGATCAATTTCGCTTTCG


QPCR-fhuC-F

AATTAATCGGCATGGGACGTT


QPCR-fhuC-R

TTTATCCGCCGCCGTTT


a Primer pairs used to assay for each gene. Primer pair QPCR-fhuA-F and QPCR-fhuA-R are used to assay transcriptional status of r2846.1777.

Morton et al. BMC Microbiology 2010 10:113   doi:10.1186/1471-2180-10-113

Open Data