Table 1

Primers used for RealTime-PCR

Primer

DNA sequence (5' → 3')

Application

Amplicon


spaP-Fw

TCCGCTTATACAGGTCAAGTTG

spaP fragment

121 bp

spaP-Rv

GAGAAGCTACTGATAGAAGGGC

gtfB-Fw

AGCAATGCAGCCATCTACAAAT

gtfB fragment

98 bp

gtfB-Rv

ACGAACTTTGCCGTTATTGTCA

gbpB-Fw

CGTGTTTCGGCTATTCGTGAAG

gbpB fragment

108 bp

gbpB-Rv

TGCTGCTTGATTTTCTTGTTGC

luxS-Fw

ACTGTTCCCCTTTTGGCTGTC

luxS fragment

93 bp

luxS-Rv

AACTTGCTTTGATGACTGTGGC

brpA-Fw

CGTGAGGTCATCAGCAAGGTC

brpA fragment

148 bp

brpA-Rv

CGCTGTACCCCAAAAGTTTAGG

ldh-Fw

TTGGCGACGCTCTTGATCTTAG

ldh fragment

92 bp

ldh-Rv

GTCAGCATCCGCACAGTCTTC


Wen et al. BMC Microbiology 2010 10:111   doi:10.1186/1471-2180-10-111

Open Data