Table 1

Oligonucleotides used in this work.

Oligonucleotide

Sequence 5'-3' *

Target tmRNA


B1

ggggacgttacggattcgac, 1–20

B. subtilis

B2

tggagacgccgggagtcgaa, 351–360

B. subtilis

L3

ttaaagccccgcaaaatgtc, 229–248

L. lactis IL1403

L4

gtcaagcctccacaacaacg, 195–214

L. lactis IL1403

L11

acggattcgacagg, 10–23

L. lactis IL1403

L12

gggagtcgaaccc, 234–246

L. lactis IL1403

E1

F-gtggaatccagaatcagcccc, 1–21

E. coli

E2

F-gcgtagttttcgtc, 96–109

E. coli

E3

F-ttgatccccgtcctaagagcgg, 154–175

E. coli

E4

F-tctcttttgggtttgacctctc, 176–197

E. coli

E5

F-tggtggagctggcgggagttgaa, 341–363

E. coli

RNA1

HRP-tgggtttgacctctcttg, 173–190

E. coli


* The type of label is either fluorescein (F-) or horseradish peroxidase (HRP-). Target sites are given after the sequences as nucleotide position numbers of the corresponding tmRNAs.

Schönhuber et al. BMC Microbiology 2001 1:20   doi:10.1186/1471-2180-1-20

Open Data