Table 1

Description of Yersinia polymorphic markers

Expected

Estimated

Number

Total

Marker

U

N

% GC

V

Primer sequences

PCR

product

size range

of Alleles

number

length (bp)

(bp)

in

of

Y.pestis

alleles


Markers polymorphic in Yersinia pestis strains


yp0120ms01

18

8

34

86

L: CTAAGCACAATTGTTATGCTGAACC

228

180 - 280

3

4

R: TACTGAATCTGCTTCATTGTTCAAA

yp1290ms04

17

8

27

96

L: CGCTGTTGAAGTTTTAGTGTAAGAA

230

160 - 240

3

5

R: AAATGTAACCTGCCAAACGTG

yp1935ms05

17

11

36

87

L: CCTCAGTTCATTGTGTAAAATCTCA

291

190 - 300

2

4

R: GTATTAGCGAGATCACAGATGAGC

yp2769ms06

60

9

48

64

L: AATTTTGCTCCCCAAATAGCAT

90 s

606

370 - 2500

3

5

R: TTTTCCCCATTAGCGAAATAAGTA

yp2916ms07

10

9

44

85

L: ATACCGCTACGATCAGCCTCTAT

184

150 - 200

2

4

R: ATTTAATATTGATTTTGGGACTTGC

yp3057ms09

18

33

65

91

L: CGTTACCCTTGTTGCCAATAGT

90 s

682

500 - 820

3

5

R: ACGCAGAACATGCTTACCTTTTAT

yp0559ms15

15

10

30

62

L: TTGACCAAGTGTAAAAGGCATAAAT

237

225 - 250

2

2

R: AAACTATCGCCAGCCATTTTAGTA

yp1814ms20

15

9

47

74

L: ACAACCTCAGTTTGCCCTTG

253

230 - 250

2

2

R: GTAAAGAGCGCAATGATCGTACT

yp1895ms21

18

9

51

76

L: GCTTAAAGCAGATTGATACTCACG

278

220 - 350

3

5

R: CTGCATGTTCACCGGTTCAG

yp4042ms35

15

8

41

59

L: CTGTTACCGGTCAAAGTGGATATT

204

195 - 225

2

3

R: AGGCTCTCCTTATCATTATTTGGTC

yp4425ms38

16

8

41

86

L: GTGAGGTATAGCTAAACGGTGATGT

233

200 - 380

3

5

R: CGCCGTAGATTATTTGTCACTTTAT

yp0581ms40

17

7

28

76

L: GCAATCATTCACCTAACCATATCTC

214

220 - 240

2

2

R: GTGCAATAGGCGTTGTTGTGTA

yp0718ms41

17

7

41

75

L: GAAGAAAGCCAGCTAATCTGATG

217

180 - 220

2

2

R: TAATGAATAGCAACGACAACCAATA

yp1018ms44

17

7

38

61

L: CAATTCCAACAGCTATTAATGCAA

233

220 - 260

2

3

R: GAATTTTCATAACACGTTCTTCCTG

yp1108ms45

12

7

65

79

L: GCATCGGAGACTGGGTAAAC

161

120 - 170

3

4

R: TTTCTGAGGATTTATCGGTGTGAT

yp1335ms46

17

7

33

73

L: CAGGTTTTACGTTATTTTCTGAAGG

252

230 - 310

3

4

R: CAGCATGAAGTATGACGGGTATATTA

yp2058ms51

18

7

37

65

L: GGTTTTTACCGATATAAATCCTGAG

207

190 - 210

2

2

R: GACCAAGAAGTTAAGTTGCTTATCG

yp2612ms54

22

7

28

82

L: GTCCACCATTTTCATACTGTCACTT

281

250 - 300

2

3

R: GCTCTTTGTTCGATTTTATTGAATG

yp3060ms56

16

7

21

81

L: AACCGACTGACTCACTTTATATTGG

220

180 - 250

2

4

R: TTCTTTTCCATTACTCAGCCTGTT

yp4280ms62

9

7

33

60

L: TTTAGTCTTGATTAAGCTGCGTTTT

240

220 - 310

3

5

R: ACGGAAGACAACCTTATTATTGATG

yp1118ms69

16

6

39

82

L: GACGTTGCAACTGCAAAAATAAG

179

165 - 180

2

2

R: ACTTGTTGTGAAGACCATCACTCT

yp1580ms70

9

6

32

97

L: AAACCAACGGTTCATATTGAATAAA

146

140 - 170

3

5

R: CTTCTTCCGCTATTTTCCTACAGA

yp1925ms71

14

6

45

91

L: GCTACTCGAATATGAGTTAGCCAAA

171

145 - 210

2

4

R: ATTGCCATATTGGATGCTAAAATAA

yp3236ms73

18

6

40

89

L: AATACCCTGTGGGTGATAATGAAC

225

175 - 230

2

3

R: ATCGATTTAGGTACCACCAATTCA

yp3245ms74

15

6

44

83

L: CCCCGACTTATATCAAGCACTG

195

180 - 225

3

3

R: AACTGACGATCTTTTTCACTGAGTT


Markers polymorphic in 5 Yersinia strains (monomorphic in pestis)


yp0802ms02

18

12

49

86

L: CTGACACAAAACGAGAGCCTATTT

53°C

314

240 - 315

1

2

R: AGCGTGAGTGGGCTATCAATAC

1 min

yp2925ms08

15

12

39

63

L: AGCCTTTTTGTTGATTATCAGTCAT

270

270 - 290

1

2

R: CGATAATAATACTGAATTACCGGATG

yp4411ms10

14

8

32

69

L: ATCATGCTTTTGCCTCAATATAATC

191

190 - 210

1

2

R: GAAACGCAGTCCCTGTTGTAG

yp0813ms16

17

8

39

64

L: GTTGGTTATCCGACAGTCTTCAATA

235

230 - 270

1

2

R: GCAATTCGTTATGGCTTAGTAAAAA

yp1269ms18

27

9

54

55

L: GCAAAAGCTGAAGCAGATAAAATAG

303

220 - 250

1

2

R: AAACCACCAAACAAATCATCAAC

yp2196ms22

20

8

12

55

L: AAACCAACAAGAAAACTGTAACCAC

90 s

265

270 - 1500

1

2

R: CATTCACCATTGATGTCCTTAGAC

yp2324ms24

19

8

34

65

L: TTCACCGGGTTACCTTAATTACATA

255

215 - 255

1

2

R: CTACCTTGCTGTCAACACTCGAC

yp2331ms25

17

9

36

76

L: AACGCGTTAATAAAACAATAAAGTG

181

190 - 230

1

3

R: CAATATCCTTTTACTCAGCCGATG

yp2679ms27

16

8

20

76

L: ATGATTACTGGCAAGAGCACTATGT

217

200 - 220

1

2

R: AACAAGATCACCTGGTCGTTAAA

yp2908ms28

18

8

40

69

L: GCAGAAATAATCTTCAGGAGAAACA

242

190 - 290

1

2

R: AGATCGTCGTTAGTCCATGTCAG

yp2958ms29

16

8

23

61

L: AAAATAGTCTGTGTTTCAGCAAAGC

215

215 - 245

1

2

R: CCTTAAAAACCCTAAGTGGGTAAAA

yp3225ms30

54

11

51

52

L: CAATAATACCATCGTGCGTGATAC

683

680 - 900

1

2

R: TATTAATGGTGGTGTTAGTCGCTGT

yp3532ms31

14

8

30

67

L: GTTATTTATTTTTGCCCCAACTTGT

217

215- 245

1

2

R: TTAGCCTGTTTGTTCTTCAAATAGC

yp3787ms32

18

8

49

65

L: CGATAACGTTAATGCCATCAGTAG

218

190 - 240

1

3

R: GCGCCGGTAAGTTTTGTTTATTA

yp3795ms33

15

8

43

67

L: CCCTTCTTTTTATGCTTGAAGATACT

210

210 - 225

1

2

R: GTTGAACCACAGGCTGTTGAG

yp4371ms37

18

8

35

82

L: TACTTAGGCATTGTCTCTTCACTCC

235

235 - 255

1

2

R: CTGAAATTATCAGTAGGTGGTTCGT

yp0999ms43

17

7

38

80

L: ATTCCACCACCAACAATTATCAC

211

220 - 300

1

3

R: GGTATTCGTATTGAAGATGACATTG

yp1962ms50

18

7

34

71

L: TACCGAGGTATTCCCTGGTCTAAT

225

225 - 240

1

2

R: AGTTGACTCCCAGTCACTTTTCC

yp3734ms59

16

7

36

69

L: ATTATCATGACCCTTCCAGTGCTAT

218

200 - 220

1

2

R: CATCAAAATGCCAGGAGAGTAAC

yp4338ms63

17

7

38

72

L: ATTAACGATTTCTTGTCGCTCAGT

194

190 - 275

1

3

R: AATCAGTAACGGCATGTGTCAGTA

yp0549ms66

18

6

41

83

L: TAAAAGCGTCAACAAAGTAGGTCAT

212

200 - 220

1

2

R: GTTCCTGTTGTTGAAAATGCTG

yp0782ms67

18

6

40

90

L: TTCCAGGCTAAAGATATTGACTTTG

248

250 - 270

1

2

R: CTCGGCTTGTTCTACGTTTAATG

yp1053ms68

18

6

32

82

L: CCGTTATCTGGTGAAAGTGAACAG

182

175 - 205

1

3

R: GTCCGGTAGCCTGATTGTTTATT

yp3634ms75

15

6

36

80

L: ATGTGAGCTTGATTGCTGAGTAGT

210

180 - 210

1

3

R: TCATATTTTAGGTGTTTTGCCTTTG


Some structural characteristics of the tandem repeats are presented : U (unit length), N (number of repeats), %GC, V (% of conservation). PCR and electrophoresis conditions are as described in the material and methods section : annealing temperature is 60°C, elongation time is 60 seconds and gels are 2% agarose except when indicated otherwise. Total number of alleles means number of alleles in 3 Y. pestis and 2 Y. pseudotuberculosis strains.

Le Flèche et al. BMC Microbiology 2001 1:2   doi:10.1186/1471-2180-1-2

Open Data