Table 2

Primers used in semi quantitative RT-PCRa and in Northern hybridzationsb

Probe set IDs c

AGIdlocus

Description

Forward Primer (5'---3')

Reverse Primer (5'---3')


A. Genes induced only in PPV-infected Arabidopsis protoplasts

256487_at

At1g31540

Disease resistance protein, TIR-NBS-LRR class

GCCAGTAGAGCTCGAGGTAAAATG

AGGCTCTTCACTGTGTTCAATCTC

246338_s_at

At3g44930

Cation/hydrogen exchanger CHX10, putative

TAACCCGAGGATCCGTGTAAC

ATCTCTAGCCGCCAGCAAATC

265682_at

At2g24390

Avirulence induced gene (AIG) protein, related

CAATGCACAGTGTCTTCGTCTA

TTCGGTAAATTCAACTCTTCAGC

254582_at

At4g19470

Disease resistance protein, related

CAGAAACGAAGACGGTGATTAC

TCTTCCTTTATTCTTTTCCTGTTC

267056_at

At2g32470

F-box family protein, related

TGGGGTTTCACAGTCAATAATAGT

TTCGCATACCAATCCCACAAC

248188_at

At5g54070

Heat shock transcription factor

TGAGTCATTGAAGGAGGAACAGAG

GAGCCACCGTCAACAAGTAGG

253366_at

At4g33180

Hydrolase family protein

TCGCAGACGCTTTCCATAGACT

GAAGAAGACAAGATCGGGAGAATA

260699_at

At1g32320

MAP kinase, putative

GACATAAAGCCTTCAAATCTCC

ATCTCCCAACAAAATCTCTAAACT

249440_at

At5g40030

Protein kinase PK1- like

CTTCAAGCCTCGGTTCCTCAA

GATCGGTTTCGGTATTTCTGGTG

B. Genes induced in PPV-infected Arabidopsis protoplasts and leaf tissues

260921_at

At1g21540

AMP-binding protein, putative

TTAGGGACCCGAGAACC

GCAGAGACTTAGCCATTTGT

258962_at

At3g10570

Cytochrome P450, putative

TCGTGAGGTTGAGGAAAAAGATG

GATAAGCGCTCCACTCAAACTC

253502_at

At4g31940

Cytochrome P450-like protein

TGCACGGTCGCTGGTTACT

AGGCGTGGCTTTAGGAATG

248989_at

At5g45200

Disease resistance protein, TIR-NBS-LRR

ATTCTTGGTGGTTGGACTG

CACTTCTCTTTGGACTTTC

257229_at

At3g16490

Calmodulin-binding family protein

AATGAATGTGGCTGTATCC

CGTTTGCGGTTGTGGTTGT


aGenes shown in panels "A" and "B" were validated using semi quantitative RT-PCR.

bGenes shown in panel "B" were validated using Northern hybridizations.

cProbe set ID represents Affymeterix probe set number.

dAGI represents Arabidopsis Genome Initiative (AGI) locus identifier that corresponds to each gene represented on the array.

Babu et al. BMC Genomics 2008 9:325   doi:10.1186/1471-2164-9-325

Open Data