Table 3

Real-time PCR primer pairs

Contig

Gene

sense

antisense

TaqMan probe

RT primer


257

Cutilcle protein

CGTCGCCGATGTGAAATAC

AAGAAGAACCTTTGTGATAGGAATC

GGATATGCCAAGTACCCCGAGT

GGCATCGTATTTTGGA

262

Hemoglobin

TTCAAAGCCAAACCCGAAGC

TTGGCAAATCCGTAATGGACA

AGAAGCTCTTTTCGGAATTCGCCAACG

AGCGTTCAGGAAATCGT

221

Metallothionein

AAACTACCCAACGGAATCAACAT

CAGTTGGGTCCGCATTTG

CCACACGAGCATTTACCTTGGCAAC

274

STKa

TTTTTAACAGAACCATCTTTGTCCAA

GACATAGTTTTTCAACATTCCTTCACAG

GTGTAAGTACGAGTTAAAGAAATTATCAGCCATC

CTGATACACAAGGTACGATAA


aSerine threonine kinase

Shaw et al. BMC Genomics 2007 8:477   doi:10.1186/1471-2164-8-477

Open Data