Table 2

Unisequences of Microbotryum violaceum blasting against pheromone receptors. For each of the four unisequences significantly blasting against pheromone receptors: best hits, primer designed for PCR amplification, expected size from the EST sequence, rough amplification size obtained, and mating type of the sporidia that gave amplification products.

Number of ESTs

Best hits

Primers

Contig size obtained from ESTs

Rough amplification size

Amplification in sporidia of mating type


Contig588

3

Rcb1 of Coprinopsis cinerea

F1: GGAAGGCCATTACAAGAAAGG

350

500

A2 only

Bbr2 of Schizophyllum commune

R2: TGTGCTTTTCGCTCTTAGCA

Contig660

4

Rcb2 of C. cinerea

F: ACGATTCCAGTAGGCGTGAA

551

800

A1 only

B alpha 8 of S. commune

R: CTGCGTCACGATACCTTTCTT

Contig2096

3

Bbr2 of S. commune

F: TCCTTTGTCACGACAAGCAC

213

220

A1 only

Rcb3 of C. cinerea

R: CCAATTTTCACGCCTACTGG

Singlet pr0aaa87yh06

1

Rcb1 of C. cinerea

F: ATCAGAATATGACGGCAGCA

383

600

A2 only

Bbr2 of S. commune

R: AAGAAAGGGAACTCCAAATGC


1 F: Forward primer

2 R: Reverse primer

Yockteng et al. BMC Genomics 2007 8:272   doi:10.1186/1471-2164-8-272

Open Data