Table 3

Sequences of primers and TaqMan probes used for qRT-PCR

Primer or probea

Oligonucleotide sequence 5'→3'


FliE F

GGAAATGCGTTCCATGCAA

FliE R

GGAGAGCATTTCCGAAAAGCT

FliE P

TTCAGGCGCCGGCCGAAG

PA0020 F

GCCGGCCTATGGCATCTT

PA0020 R

GCGTTGATGCCGAGGACTT

PA0020 P

CCAGGGCAAGGTCTACATCGATCCG

ClpP F

GGTGGTTGCTCAGTTGCTGTT

ClpP R

CGGCGAGTTGATGTAGAGATGA

ClpP P

CTGGAGGCTGAAAATCCCGAGAAGGA

PA2184 F

GCGCGGCTGGAACACTAT

PA2184 R

CCATGGGTTTCCTCGATGTG

PA2184 P

CGCAACTGAAGACGCGGATCGA

PA5555 F

CGCTGGTGGCCGATGA

PA5555 R

GGCGTCGGGTTCGTAGAGA

PA5555 P

TCAGGAGCTGAAGCACCACTGGGACT


a. Forward primers (F), reverse primers (R) and TaqMan probes (P) are displayed.

Waite et al. BMC Genomics 2006 7:162   doi:10.1186/1471-2164-7-162

Open Data