Table 3

Sets of real-time RT-PCR primers and probes for detection of TRP ion channel transcripts

Gene

Accession number

Sequence 5'-3'


TRPC3

NM_019510

for: CCAAGCTGGCCAACATAGAG

rev: GGCAAGTTTGACACGACTCA

probe: actcggaggaggtggaagccattc


TRPC4

NM_016984

for: TGGAGTGGATGATATTACCG

rev: CCACATGTCCCATGATTC

probe: TGTGATGAACTCCTTGTATCTGGCAACAA


TRPV1

NM_001001445

for: GCATCTTCTACTTCAACTTCTTCGTC

rev: CCACATACTCCTTGCGATGGC

probe: CAAACTCTTGAGGGATGGTCGCCTCT


TRPV5

NM_001007572

for: CAAGAAGAAAGAGGCTCGAC

rev: AATGACTGTCACCAACTCCC

probe: CCGTACACATGTTCGAGATAACACCATCA


TRPM2

NM_138301

for: CAGATCCCAACCTACATTGACG

rev: GAAGGTGTAGTTGAACATGGCGA

probe: ACCAGTGCAGCCCCAATGGCA


TRPM3

NM_177341

for: CAAAGATGACATGCCCTATATGA

rev: CTTTCTTTCTGGATGATTCCC

probe: ATGAAGAGGACATGGAGCTAACAGCAA


TRPM4

NM_175130

for: CCCTGAGGATGGTGTTGAGT

rev: AGGAGCACTGGGATGTCAAT

probe: CTTCTTGGTGGATGATGGCACC


TRPM6

NM_153417

for: CCAGGTGCCGGTAATAACA

rev: CTCTTGTGGCTGCCTTAGGT

probe: CAGTTGAATGCAGAGCCAGGAGAAAC


The sets of PCR primers and TaqMan fluorogenic probes were obtained from TIBMOLBIOL.

Kunert-Keil et al. BMC Genomics 2006 7:159   doi:10.1186/1471-2164-7-159

Open Data