Table 1

Primers used for standard RT-PCR

Gene

Accession number, product size & references

Sequence 5'-3'


TRPC1

NM_011643

371 bp [11]

for: CAAGAT TTTGGGAAATTTCTGG

rev: TTTATCCTCATGATTTGCTAT


TRPC2

NM_011644

326 bp [29]

for: GATCCGGTTCATGTTCATCCT

rev: GAGCGAGCAAACTTCCACTC


TRPC3

NM_019510

317 bp [11]

for: TGACTTCCGTTGTGCTCAAATATG

rev: CCTTCTGAAGCCTTCTCCTTCTGC


TRPC4

NM_016984

414 bp [11]

for: TCTGCAGATATCTCTGGGAAGGATGC

rev: AAGCTTTGTTCGAGCAAATTTCCATTC


TRPC5

NM_009428

339 bp [11]

for: ATCTACTGCCTAGTACTACTGGCT

rev: CAGCATGATCGGCAATGAGCTG


TRPC6

NM_013838

326 bp [11]

for: AAAGATATCTTCAAATTCATGGTC

rev: CACGTCCGCATCATCCTCAATTTC


TRPC7

NM_012035

692 bp

for: CGTGCTGTATGGGGTTTATAATG

rev: GCTTTGGAATGCTGTTAGAC


TRPV1

NM_001001445

320 bp

for: GCATCTTCTACTTCAACTTCTTCGTC

rev: CCACATACTCCTTGCGATGGC


TRPV2

NM_011706

427 bp

for: CGGCACTTCCTCTCT

rev: GTCGGTCACGGTCAA


TRPV3

NM_145099

298 bp

for: CAAGGACTGCCACCACCATC

rev: CATCACAGTTGCCAGAGAGG


TRPV4

NM_022017

249 bp

for: GAGTCCTCAGTAGTGCCTGG

rev: CAACAAGAAGGAGAGCAGTC


TRPV5

NM_001007572

172 bp [30]

for: CGTTGGTTCTTACGGGTTGAA

rev: GTTTGGAGAACCACAGAGCCTCTA


TRPV6

NM_022413

318 bp

for: AACCAGCCTTCCACC

rev: CCTCCATTAGCACCA


TRPM1

NM_018752

446 bp

for: TATCCTATGACACCAAGCCA

rev: GGTCTTCCTTATTCTCCACG


TRPM2

NM_138301

215 bp

for: CAGATCCCAACCTACATTGACG

rev: GAAGGTGTAGTTGAACATGGCGA


TRPM3

NM_177341

497 bp

for: CCTGTTCTTCTGGCA

rev: GCTTCTCTGGCTCCT


TRPM4

NM_175130

176 bp

for: CCCTGAGGATGGTGTTGAGT

rev: AGGAGCACTGGGATGTCAAT


TRPM5

NM_020277

360 bp

for: CAGATACTGAGGATGGCTGG

rev: GGATCTTGGTGGATGTGCTA


TRPM6

NM_153417

219 bp

for: CCAGGTGCCGGTAATAACA

rev: CTCTTGTGGCTGCCTTAGGT


TRPM7

NM_021450

295 bp

for: CGGAGCTGGTCGCACAATTA

rev: CCTGGAAGACATCTGTGAGG


TRPM8

NM_134252

344 bp

for: TCCACGAGACTTCTTCACTT

rev: GTGTATCTGAGGTCAGTCTT


GAPDH

NM_008084

451 bp

for: ACCACAGTCCATGCCATCAC

rev: TCCACCACCCTGTTGCTGTA


Primers described in the literature are indicated (references). All other primers were newly designed.

Kunert-Keil et al. BMC Genomics 2006 7:159   doi:10.1186/1471-2164-7-159

Open Data