Table 1

DraI SNP primers, locations and band sizes. In each pair of primers, the left primer is listed first; all primer sequences are given 5' to 3'. Interpolated genetic positions are from [9] release WS143.

Genetic Location

Physical Location

Clone

N2 digest

CB4856 digest

Primers

Wormbase Identifier


I, -19

169, 017

F56C11

354, 146

500

ATGCCAGTGATAAGGAACGG

snp_F56C11 [4]

TCACATCCCTTGTCGATGAA

I, -12

1,905,969

Y71G12A

503, 72

377, 126, 72

TCGAAATCAGGGAAAAATTGA

snp_Y71G12 [3]

ACGATTTTCGGGGAGTTTTT

I, -6

2,818,973

W03D8

395, 144

538

GTTTTCACTTTTGCCGGTGT

pkP1052

TGAAGGCGCATATACAGCAG

I, -1

4,594,014

D1007

325, 134, 41

459, 41

AAAATATCAGGAAAGAGTTTCGG

snp_D1007 [7]

TTTAAAGATTAAGGGTGGAGCG

I, 5

10,722,146

B0205

494

365, 129

ATCTGGCACCAAATATGAGTCG

CE1-247

AATCTCGATTTTCAAGGAGTGG

(rs3139013)**

I, 13

12,047,594

F58D5

445

295, 151

TCCTGGATAATCCCCAAAAA

snp_F58D5 [4]

CCCTGCCATTGATCTTGTTT

I, 14

12,729,812

T06G6

236, 99, 78

335, 78

TTGAAATCCCCTTTAAAATCCC

uCE1-1361

ACACTGGGTACCTGACTCATGC

I, 26

14,682,016

Y105E8B

360, 114, 27

474, 27

ATTATTAACGGCCACGGTGA

snp_Y105E8B [3]

CCCACACACTCTCACCTTCA

II, -18

176,720

T01D1

263, 112

375

CCGAATTTTCAAATGGATGC

pkP2101

CCATTGGAATTGCACACAAA

II, -14

2,121,018

R52

345

236, 109

CTGTGCTGTTGACGATATTGG

snp_R52 [5]

ATGTCTCATTGCAAAATTCGG

II, -6

3,828,599

F54D10

516

387, 129

TTGTGAGCTTATATCTCAGTTGTCG

pkP2103

AGATTTGGTTAGAAATATCACCGC

II, 1

9,052,466

T24B8

373, 121

494

TCAAAAACTTACAATCAATCGTCG

snp_T24B8 [1]

CCAGAAAATCTGCACAGAAGG

II, 4

11,827,835

Y6D1A

224, 117, 124, 44

340, 124, 44

TTCTTCAAAAAGTCTAGGTTCAGCA

snp_Y6D1 [1]

GGGGACGAAAACGGAGTTTG

II, 11

12,605,350

Y38E10A

483

352, 132

ACCGTTTAATAGGATTATTTGGG

uCE2-2131

AAGTCTGCGGAATAATTGATGG

II, 16

13,235,564

F15D4

500

368, 132

TTCCAGGTAATACACATACAACTCC

pkP2116

AAAAACACAAAGTTCAAAAACCC

II, 22

14,132,466

K09E4

365, 119

484

CCACTGGCTATAAGCTTTTCTAGG

CE2-215

TAAGGATTTCAGGCTTTTAGGC

(rs3139227)**

III, -25

939,698

T12B5

206, 189

395

TATCATCGAAATCCCGGAAA

uCE3-637

TTCGGACGGGAGTAGAATTG

III, -19

1,827,732

Y39A3CL

342, 78, 76

272, 78, 76, 70

TCCCAATTTCCCTCTAAAAACC

uCE3-735

TTGAATTTGGACCATTTTGAGG

III, -12

2,599,699

Y71H2B

368, 105

473

GAGGAACCAAATCTGGCGTA

snp_Y71H2B [2]

TGAAAACTTGGAAAATCGGTG

III, -7

3,359,033

F45H7

239, 85, 27

196, 85, 43, 27

AATTTGAATCAGTGACTTTTGGC

CE3-127

TTTCTGCAAACATTTTTCTTCG

(rs3139272)**

III, -1

7,320,107

F56C9

486

354, 132

AAAAATACATGTCTACACAACCCG

snp_F56C9 [1]

TTTCTTATCACTGTGCAGTCTTACC

III, 4

10,652,476

Y39A1A

355, 142, 30

497, 30

AGCGTTAAAGTATCGGTTATTTCG

snp_Y39A1 [9]

TAAATTCATTTCAAACAATCGAGC

III, 12

11,656,188

Y41C4A

339, 156

495

ATCAAGTTTCTGATTGCTCTTTCC

snp_Y41C4 [2]

AAAAACGTGATTTTTCAATTTTGC

III, +21

13,715,622

W06F12

273, 137, 78

200, 137, 78, 73

AGCAGGCTCACCATCATCATCA

uCE3-1426

GACATTACGGTAGAGGAGATGGA

IV, -24

795,461

F56B3

301, 128, 71

429, 71

TGATGGTGTGTCTGCGTACC

uCE4-515

AGAGCTGGAGAGCACGGATA

IV, -16

1,799,032

Y38C1BA

187, 304

491

CGCATAAATCCAACGTTCTCTG

snp_Y38C1B [2]

AATCCATAAGTTTCGTGTTGGG

IV, -7

2,761,525

Y54G2A

498

250, 248

ACTCGGCATCCTCACGC

snp_Y54G2 [5]

GTTGAAAATTTTTTCATAGCTATCATC

IV, -5

3,347,952

F42A6

295, 124

419

TGCTGAAATATTGGAAAATTGAGG

pkP4055

TTATATCGTCGAGGAGGTTAGAGG

IV, 1

4,991,851

E03H12

376

300, 76

AAAATGGGAAGCGTACCAAA

pkP4071

TGCTTGTAGCGTTTCCAAGA

IV, 8

13,049,020

F49E11

313, 77

390

GACACGACTTTAGAAACAACAGC

snp_F49E11 [1]

TGGTATGGAGTCCCTATTTTGG

IV, 12

14,566,396

Y57G11B

284, 162, 52*

327, 119, 52*

TGTAAATACCCCACATTTCAAGC

snp_Y57G11B [2]

AAATTTCCAATTGTTCAAAGCC

pkP4095*

IV, 14

16,085,085

Y105C5B

241, 108, 78, 48

319, 108, 48

TCGAATTGTTGTGTTTCTTTTGA

pkP4099

TTCCAATTTTCTCGGTTTGG

V, -17

1,773,464

F36H9

307, 87, 79

386, 87

TTTCGGAAAATTGCGACTGT

pkP5076

CGCGTTTTGGAGAATTGTTT

V, -13

2,726,662

C24B9

288, 167

455

TCATCTGTTATTTCGTCTCTTGC

uCE5-828

CGGTAATAATATGCTTTGTGGG

V, -5

4,550,757

Y61A9LA

454

307, 147

GAGATTCTAGAGAAATGGACACCC

snp_Y61A9L [1]

AAAAATCGACTACACCACTTTTAGC

V, 1

7,089,411

VC5

435, 70

300, 135, 70

AGAAATGATCCGATGAAAAAGC

pkP5097

CCGATAGTGTTCATAGCATCCC

V, 6

13,951,850

R10D12

500

348, 152

CAAATTAAATATTTCTCAAAGTTTCGG

***

ACATAAGCGCCATAACAAGTCG

V, 10

16,321,481

F57G8

475

288, 187

TAAAGCCGCTACGGAAATACTC

pkP5129

ATTTTCTCCCTAATTCCAGGTG

V, 13

17,610,508

Y6G8

282, 205

487

CATTCATTTCACCTGTTGGTTG

uCE5-2609

TCGGGAAGATAATCAAAATTCG

V, 18

18,782,547

Y17D7B

324, 164

488

GAAATTCAAATTTTTGAGAAACCC

snp_Y17D7B [3]

TTCAGACCATTTTTAGAATATTCAGG

X, -17

2,065,464

F49H12

540

321, 219

ATATGTGAGTTTACCATCACTGGG

pkP6143

ACGTTTTGAAAAATTTGGTTGC

X, -8

4,161,493

ZK470

422, 72, 40

326, 96, 72, 40

CCAAAACGGCCAAGTATCAG

pkP6105

TTGCACTCTTTCTCCTTCCG

X, -4

5,934,688

C46F4

169, 54, 51, 35, 22

223, 51, 35, 22

AAGTGTTCAATGATTTTGTCTAATTG

uCE6-981

TGACAGGAGAATACTTTTGAAGG

X, 2

10,637,922

F11A1

409, 133

542

AGCAACAAACAATGCAACTATGG

snp_F11A1 [2]

TAAACAAGAGGGTACAAGGTATCG

X, 8

12,750,713

F22E10

341, 126

467

TTAAAACCATACAATTCTTCTCAGC

snp_F22E10 [1]

GAATTCCCAATCAACAGAGAGC

X, 11

13,339,566

F46G10

318, 191, 37

509, 37

ACTGTTTACCGCGTCTTCTGC

pkP6132

CCGTGTATATAAGAAAATGTGTTCG

X, 17

14,547,382

T24C2

409, 34

302, 107, 34

GCTGGGATTTTGAAGAGTTGTT

uCE6-1459

CAGTGAATCATCCGTTGAATTT

X, 23

15,500,013

H13N06

358, 134

492

CAAATACCAAAGTTGATCGTGG

uCE6-1554

TTGTTGCAATTAAATCAAACGG


*Y57G11B has two DraI SNPs within a single PCR product.

**dbSNP IDs are given where the SNP has been submitted to the NCBI dbSNP database [10].

***The SNP on R10D12 has not been added to wormbase. It can be found at [11]

Davis et al. BMC Genomics 2005 6:118   doi:10.1186/1471-2164-6-118

Open Data