Table 4

Specific primers used to assess quality and absence of DNA contaminants of the RNA samples, and randomly selected primers used to generate cDNA profiles.

Primer code

Sequence


actin F (Apis)

5' AGCTATGAACTTCCAGATGGT 3'

actin R (Apis)

5' CCACATCTGTTGGAAGGT 3'

16S mitochondrial F (Apis)

5' TTATTCACCTGTTTATCAAAACAT 3'

16S mitochondrial R (Apis)

5' 'TATAGATAGAAACCAAYCTG 3'

16S mitochondrial F (Drosophila)

5' CCGGTCTGAACTCAGATCACGT 3'

16S mitochondrial R (Drosophila)

5' CGCCTGTTTAACAAAAACAT 3'

p3_2

5' TTGGGGATCGTATGTAGTATG 3'

pA82_1

5' CACTTCAGGATCCCTTGTAAGC 3'

pA82_2

5' CCAACATTGAATTCTCTTTGAC 3'

pA82_4

5' CAATAACAATGAATTCCAGAATCTCG 3'

pPT7C4_B

5' GCTTACAAGGGATCCTGAAGTGTTTCC 3'

pPT7C4_XS

5' GCAGGTAAACTCTACTCGAGTTACG 3'

M-RON-AS

5' CCAGGATGTTTGGGTGATGTA 3'

CREB-S

5' TCATGCAACATCATCTGCTCC 3'

H-SPARC-S

5' CTAACCCAAGACATGACATTC 3'

M-CD151-S

5' AAAGCTCGGAGGCAGCGAACT 3'

H-CD151-AS

5' CATGTGGCTGCAAGGCAAAGC 3'

M-SPARC-AS

5' GCCCAATTGCAGTTGAGTGAT 3'

M-ETS1-AS

5' GTCTTGATGATGGTGAGAGTC 3'

FUT-3-S

5' TCATGTCCAACCCTAAGTCAC 3'

FUT-3-AS

5' TCCAGCAGGCCTTGCAGAAAT 3'

M-CMET-S

5' TATCTCAAACGATCGAGAGAC 3'

M-CMET-AS

5' GCACATCTATTACCAGCTTTG 3'

H-CMET-S

5' TTTCAAATGGCCACGGGAC 3'

H-CMET-AS

5' GCACATTTATGACCATTCTCG 3'

H-Rhoc-AS

5' AGAAACAACTCCAGGGGCCTG 3'

M-Rhoc-AS

5' CTACCCAAAGCAGAAACCCCA 3'

H-Sparc-AS

5' CCAAAACCATCCTTGACAACA 3'

H-RON-AS

5' TGATGAGGTCCTTCACGGTG 3'

B237-2

5' CGGAATTCACCAGATTTGAACAGAAGAG 3'

B237-3

5' AACTGCAGTTAACCAGATTTGAACAGAAA 3'

GST_(PGEX)_NHE_I-S

5' CCGCTAGCATGTCCCCTATACTAGGTTA 3'

HOXA_I-F

5' CGCTCCCGCTGTTTACTCT 3'

P21-RasaI-F

5' GACCGCTCCTCCAACTAACC 3'

P21-RasaI-R

5' CCGGCCCACCTCTTCTACTA 3'

SRY8299.2

5' TCTCTTTATGGCAAGACTTACG 3'

SRY1532.1

5' TCCTTAGCAACCATTAATCTGG 3'

92R7.2

5' GCCTATCTACTTCAGTGATTTCT 3'

TAFIEX.1R

5' ATCCAAGGTTCTCCCAATA 3'


Nunes et al. BMC Genomics 2004 5:84   doi:10.1186/1471-2164-5-84

Open Data