Expression profile of genes regulated by activity of the Na-H exchanger NHE1
-
* Corresponding author: Diane L Barber barber@itsa.ucsf.edu
1 Department of Stomatology, University of California San Francisco, San Francisco, CA 94143, USA
2 Office of Research Technology Transfer Center, University of California, Davis, Davis, CA 95616, USA
BMC Genomics 2004, 5:46 doi:10.1186/1471-2164-5-46
The electronic version of this article is the complete one and can be found online at: http://www.biomedcentral.com/1471-2164/5/46
| Received: | 24 March 2004 |
| Accepted: | 16 July 2004 |
| Published: | 16 July 2004 |
© 2004 Putney and Barber; licensee BioMed Central Ltd. This is an Open Access article: verbatim copying and redistribution of this article are permitted in all media for any purpose, provided this notice is preserved along with the article's original URL.
Abstract
Background
In mammalian cells changes in intracellular pH (pHi), which are predominantly controlled by activity of plasma membrane ion exchangers, regulate a diverse range of normal and pathological cellular processes. How changes in pHi affect distinct cellular processes has primarily been determined by evaluating protein activities and we know little about how pHi regulates gene expression.
Results
A global profile of genes regulated in mammalian fibroblasts by decreased pHi induced by impaired activity of the plasma membrane Na-H exchanger NHE1 was characterized by using cDNA microarrays. Analysis of selected genes by quantitative RT-PCR, TaqMan, and immunoblot analyses confirmed results obtained from cDNA arrays. Consistent with established roles of pHi and NHE1 activity in cell proliferation and oncogenic transformation, grouping regulated genes into functional categories and biological pathways indicated a predominant number of genes with altered expression were associated with growth factor signaling, oncogenesis, and cell cycle progression.
Conclusion
A comprehensive analysis of genes selectively regulated by pHi provides insight on candidate targets that might mediate established effects of pHi on a number of normal and pathological cell functions.
Background
Intracellular pH (pHi) homeostasis is exquisitely controlled. Variations in pHi both reflect and determine changes in a number of cellular processes, including adhesion, proliferation, metabolism, and programmed cell death. How pHi responds to and regulates distinct cellular processes has primarily been determined by evaluating protein activities. Although effects of pHi on gene expression have been determined in yeast [1] and bacteria [2], we know little about how pHi regulates gene expression in metazoan cells.
In metazoan cells pHi homeostasis is maintained by a number of H+ translocating mechanisms, primarily localized at the plasma membrane. In mammalian fibroblasts, a predominant regulator of pHi is the Na-H exchanger, NHE1. NHE1 is an H+ extruder, catalyzing an electroneutral exchange of extracellular Na+ for intracellular H+ and regulating pHi and cell volume homeostasis. NHE1 activity is increased in response to growth factors and oncogenes [3,4], and increases in NHE1 activity and pHi promote cell cycle progression [5], increased proliferation [6,7], and cell survival [8]. NHE1 activity is necessary for a number of cytoskeleton-associated processes including cell shape determination [6], remodeling of cell-substrate adhesion complexes [6,9,10], and directed cell migration [9,11,12]. NHE1-dependent increases in pHi also play an essential role in cell transformation and the development of malignant progression [13,14] and NHE1-deficient cells have a markedly reduced capacity for tumor growth in vivo [15].
In this study we used cDNA microarray analysis to determine changes in steady-state gene expression in fibroblasts stably a mutant NHE1 lacking ion translocation activity compared with fibroblasts stably expressing wild-type NHE1. Consistent with a role for NHE1 in cell growth regulation, the unbiased microarray analysis indicated that in the absence of NHE1 activity there are significant changes in the expression pattern of genes related to growth factor signaling, growth and oncogenesis, and DNA synthesis and cell cycle control.
Results and Discussion
Global gene profiling
Recent evidence indicates that in addition to the function of NHE1 in ion translocation and pHi homeostasis, the exchanger also acts as a scaffold to assemble signaling complexes and as a plasma membrane anchor for the actin-based cytoskeleton [3,6]. To selectively impair only ion translocation by NHE1, we engineered an ion translocation-defective NHE1 containing an isoleucine substitution for glutamine 266 (NHE1-E266I). In cells expressing NHE1-E266I, the scaffolding and actin anchoring functions of NHE1 are retained, but ion translocation is absent [5,6]. Wild-type NHE1 (LAPN cells) and NHE1-E266I (LAPE cells) were stably expressed in NHE1-null LAP1 cells, which are derived from NHE1-expressing Ltk-mouse muscle fibroblasts [16,17]. As previously reported [5] NHE1 expression in LAPN and LAPE cells, as determined by immunoblotting, is similar and steady-state pHi in the continuous presence of serum and HCO3- is ~7.35 for LAPN cells and ~7.10 for LAPE cells. The presence of HCO3- allowed the function of anion exchangers contributing to pHi homeostasis in the absence of ion translocation by NHE1.
For DNA microarray analysis, significant regulation of genes in LAPE cells compared with LAPN cells was defined as a fold change > 1.5 with a p value of < 0.05 from five independent cell preparations and microarray hybridizations. Of the 6,500 probe sets, 198 or 3.05% were significantly different in LAPE cells. Two widely used approaches to analyze DNA microarray data include hierarchial clustering of genes with similar expression patterns [18] and grouping of biologically related genes into processes or pathways [19,20]. We used the latter strategy to group genes regulated by NHE1 activity into related biological pathways or processes. Genes were grouped according to key-words representing functional categories and GenMAPP, developed by the Conklin laboratory at the University of California, San Francisco [20,21], was used to visualize gene expression data on maps representing biological pathways. The advantage of a pathway-based analysis is that it provides a global perspective of functionally-related genes. Pathway-based grouping indicated a substantial number of differentially expressed genes associated with growth factor/hormone signaling and growth and oncogenesis (Fig. 1). The caveat of pathway-based analyses is that based on key-word representation, some genes are implicated in multiple biological processes. Hence, we listed all genes exhibiting significant changes in LAPE cells compared with LAPN cells (Table 1). Data in Table 1 are grouped according to biological function with absolute changes indicated.
Figure 1. Relative functional clustering of genes differentially regulated in LAPE cells. Percentage of genes in the indicated functional categories that were regulated (A),
had increased expression (B), and decreased expression in LAPE cells compared with
LAPN cells (p < 0.05, n = 5).
Table 1. Differential Gene Expression in LAPE Cells Relative to LAPN Cells
Growth factor and oncogenic signaling
The expression of a substantial number of genes encoding proteins related to growth factor/hormone signaling and growth and oncogenesis was altered in LAPE cells compared with LAPN cells. A schematic cascade of growth factor signaling indicates that a number of genes regulated in LAPE cells function in Ras-dependent signaling (Fig 2A). Activation of many of these signaling proteins, including serotonin (5HT) [22] and thrombin (PAR2) [23] receptors, Ras [13], Raf [24], PLCγ1 [25], and Erk [26,27] stimulates NHE1 activity. Increased NHE1 activity and a resulting intracellular alkalinization are thought to be necessary for oncogenic transformation [14] and tumor development [15]. Immunoblot analysis confirmed increased protein expression of Fyn, PLCγ1, and ERK2 in LAPE cells compared with LAPN cells (Fig. 2B), In LAPE cells, the global increased expression of a number of genes involved in growth factor and oncogenic signaling suggests a feedback response to acidic or osmotic stress. Alternatively, because the proliferative response is suppressed in LAPE cells [5] (Fig. 3), increased growth factor signaling could result from a feedback mechanism to maintain cell proliferation.
Figure 2. Genes differentially regulated in LAPE cells grouped as functioning in growth factor
signaling and transcriptional regulation. A. Schematic diagram of growth factor signaling and transcriptional regulation. Red
indicates genes with increased expression in LAPE cells compared with LAPN cells,
and blue indicates genes with decreased expression. B. Immunoblot analysis of the
indicated proteins confirmed increased protein expression in LAPE cells predicted
by GeneChip data. C. Relative RT-PCR for the transcription factor C/EBP delta confirmed
GeneChip data of increased expression in LAPE cells compared with LAPN cells. D. TaqMan
analysis confirmed increased expression of GADD153 in LAPE cells compared with LAPN
cells. Data in A represent the means of fold-increase or – decrease in LAPE cells
(p < 0.05, n = 5). Data in B, C, and D are representative of 2 to 3 separate cell
preparations.
Figure 3. Genes differentially regulated in LAPE cells grouped as functioning in the G2/M transition
of cell cycle progression and DNA damage checkpoint. A. Schematic diagram of G2/M regulation. Red indicates genes with increased expression
in LAPE cells compared with LAPN cells, and blue indicates genes with decreased expression.
B. Immunoblot of GADD45 confirmed decreased protein expression in LAPE cells compared
with LAPN cells. C. Immunblotting for FEN1 and cyclin B1 at the indicated times after
release from a double thymidine block. C. Relative TaqMan expression of Wee1 kinase
confirmed GeneChip data of increased Wee1 expression in LAPE cells compared with LAPN
cells. Data in A represent the means of fold-increase or – decrease in LAPE cells
(p < 0.05, n = 5). Data in B and C are representative of 2 to 3 separate cell preparations.
Data in D represent the mean ± s.e.m. of 3 separate cell preparations.
Expression of a number of transcription factor genes acting downstream of growth factor signaling was also differentially regulated in LAPE cells compared with LAPN cells (Fig. 2A). Fra1 and Fra2 are Fos proteins and components of the AP1 transcription factor. They form dimmers with Jun transcription factors to regulate a number of cell processes including differentiation, proliferation, and oncogenic transformation [28]. The regulated expression of two members of the C/EBP (CAAT/enhancer binding protein) family of transcription factors was confirmed. RT-PCR was used to confirm decreased expression of C/EBPδ (Fig. 2C), which dimerizes with C/EBPβ in response to Ras-ERK signaling to regulate adipocyte [29,30] and epidermal [31] differentiation. Increased expression of GADD153 (CHOP), which is a transcription factor in the C/EBP family, was confirmed by TaqMan analysis (Fig. 2D). GADD153 dimerizes with other C/EBP isomers to inhibit their binding to C/EBP binding sites in the promoters of a number of genes involved in differentiation and mitogenesis [32,33]. Expression of GADD153 increases in response to DNA damage [34], and oxidative stress [35,36], hence its role in cell cycle progression is also included in Figure 3.
Cell cycle regulation
NHE1 activity has a permissive effect in promoting cell proliferation [6,7] and cDNA microarray analysis indicated a number of genes with roles in DNA synthesis and cell cycle control had altered expression in LAPE cells compared with LAPN cells. We recently reported [5] that the proliferative rate of LAPE cells is ~3 to 4-fold less than that of LAPN cells and that LAPE cells lack a pH-dependent timing of cell cycle progression that is specifically associated with delayed G2/M entry and transition. Consistent with these findings there was an upregulation of genes associated with G2/M arrest and DNA repair responses (Fig. 3A). Decreased protein expression of GADD45 and FEN1 was confirmed by immunoblotting (Fig. 3B,3C). The decrease in FEN1 in LAPE cells was most marked when cells were synchronized by a double thymidine block, and released from the block for 3 to 9 hours (Fig. 3C). GADD45, which acts in DNA repair, is generally upregulated with cell cycle arrest [37,38], and FEN1 is thought to play an essential role in DNA replication and in base excision repair [39,40]. Although decreased expression of GADD45 and FEN1 in LAPE cells appears paradoxical, recent findings indicate that a decrease in GADD45 would contribute to p53 instability [38] and FEN1 is stimulated by proliferating nuclear antigen [41], which is decreased in LAPE cell (Fig. 3A). Additional growth arrest and DNA damage-inducible proteins, including Rad54 and GADD153, were upregulated. Rad54 functions in homologous recombination repair pathways to maintain telomere length [42] and it facilities chromatin remodeling [43], which correlates with increased histone H3 in LAPE cells (Fig. 2). As described above, increased GADD153 expression, which was confirmed TaqMan analysis (Fig. 5B), is induced by growth arrest, DNA damage, and environmental stress. Despite an established role for GADD153 in inducing apoptosis [44,45], and its increased expression in LAPE cells (~45-fold), there was no indication that LAPE cells have increased necrosis or apoptosis compared with LAPN cells.
Figure 5. Expression of cytoskeleton and extracellular matrix genes differentially regulated
in LAPE cells. A. Immunoblotting for gelsolin (top panel) and zymography for type IV collagenase
(MMP-9) activity (bottom panel) confirmed increases and decreases, respectively, in
LAPE cells compared with LAPN cells observed with GeneChip data. B. Relative TaqMan
analysis indicated decreased p24p3 expression in LAPE cells, consistent with GeneChip
data.
Consistent with LAPE cells having delayed G2/M entry and progression [5], the array analysis indicated upregulation of genes negatively regulating G2/M, including 14-3-3 θ and Wee1 kinase. Increased expression of Wee1 kinase, which induces inhibitory phosphorylation of Cdc2 on tyrosine 15 [46], was confirmed by TaqMan analysis (Fig. 3D). Moreover, there was a downregulation of genes associated with promoting cell cycle progression, including CDC25 (Fig 3A) and CKS-2 (Fig. 3A), and involved in chromatin assembly, including histone H3 (Fig. 2A). Although cDNA array analysis of asynchronous LAPE cells did not indicate a change in cyclin B1 expression, we found that with a time-dependent release of cells from a double thymidine block, cyclin B1, as indicated by immunoblotting, was significantly downregulated in LAPE cells compared with LAPN cells (Fig. 3C). Hence, loss of NHE1 activity likely decreases the stability of cyclin B1 protein rather than decreasing cyclin B1 gene expression. Decreased cyclin B1 expression and increased Wee1 kinase expression is consistent with our previous finding that Cdc2 kinase activity is inhibited in LAPE cells compared with LAPN cells [5].
Carbohydrate metabolism, electron transport and oxidative phosphorylation
A global pattern of metabolic genes differentially regulated in LAPE cells would favor glycolysis and oxidative phosphorylation, possibly in response to reduced ATP (Fig. 4A). Paradoxically, expression of genes encoding enzymes that regulate substrate entry for glycolysis was decreased. Decreased expression of the glucose transporter Glut-4 was confirmed by TaqMan analysis (Fig 4B). Additionally, decreased phosphorylase kinase would favor decreased conformational change of phosphorylase b to phosphorylase a, and reduced glycogen breakdown to glucose 6-phosphate and decreased galactokinase would favor decreased utilization of galactose for glycolysis. Key regulators of glycolytic flux, however, including hexokinase, phosphofusctose kinase, and pyruvate kinase were upregulated in LAPE cells compared with LAPN cells. Increases in hexokinase and phosphofusctose kinase, which catalyze the first and second ATP ultilization steps of glycolysis, respectively, and in pyruvate kinase, which catalyzes the final reaction of glycolysis, would favor increased production of pyruvate. Phosphorylation of fructose 6-phosphate by phosphofusctose kinase is a rate-determining reaction and the activity of phosphofusctose kinase is stimulated by low AMP and inhibited by high ATP and by citrate. In LAPE cells, a decrease in citrate transport protein would likely decrease cytosolic citrate, a negative regulator of phosphofusctose kinase, and indirectly increase phosphofusctose kinase activity. Glycolytic flux and NADH would also be favored by decreased expression of fructose 1,6-bis-phosphate, which limits substrate recycling, and lactate dehydrogenase, which catalyzes the reduction of NADH by pyruvate to yield NAD+ and lactate. An established metabolic difference in oncogenic transformed cells compared with normal cells is increased lactic acid production [47] and decreased lactate dehydrogenase in LAPE cells correlates with increased NHE1 activity being necessary for oncogenic transformation [14] and tumor development [15].
Figure 4. Genes differentially regulated in LAPE cells grouped as functioning in glycolysis,
electron transport and oxidative phosphorylation. A. Schematic diagram of carbohydrate metabolism and oxidative phosphorylation. Red
indicates genes with increased expression in LAPE cells compared with LAPN cells,
and blue indicates genes with decreased expression. B. Relative TaqMan expression
of Glut-4 confirmed GeneChip data of decreased Glut-4 expression in LAPE cells compared
with LAPN cells. Data in A represent the means of fold-increase or – decrease in LAPE
cells (p < 0.05, n = 5). Data in B are representative of 2 separate cell preparations.
Consistent with increased glycolysis and pyruvate production in LAPE cells, key enzymes favoring ATP production by electron transport and oxidative phosphorylation were increased (Fig. 4A). Increases in NADH-ubiquinone oxidoreductase and cytochrome c oxidase would favor oxidation of NADH. Increases in subunits A, C, and D of ATP synthase would increase endergonic synthesis of ATP. ATP synthase in the inner mitochondrial membrane is a proton translocator, extruding protons into the mitochondrial matrix. Whether decreased cytosolic pH in LAPE cells compared with LAPN cells alters the pH of the mitochondrial matrix and proton-electromotive force powering ATP synthesis remains to be determined. Collectively, the profile of gene expression in LAPE cells suggests equilibrium towards increased glycolytic flux and ATP production.
Cytoskeleton and extracellular matrix
cDNA array analysis indicated that loss of NHE1 activity in LAPE cells was associated with the regulation of a number of genes involved in cytoskeleton organization, cell adhesion, and extracellular matrix assembly. The regulation of several genes correlates with reported effects of NHE1 activity and pHi on cell shape determination [6], cell polarity [9], actin-filament bundling [9,48], cell-substrate adhesion [9,10] and cell migration and metastasis [9,11,14]. NHE1 acts as an anchor for actin filaments by binding directly members of the ERM (ezrin, radixin, moesin) family of actin binding proteins, and in LAPE cells, expression of NF2 (merlin), a tumor suppressor protein and member of the ERM family, was downregulated. Consistent with a role for NHE1 activity in cell polarity and actin dynamics, loss of NHE1 activity was associated with decreased expression of myosin regulatory light chain, and increased expression of gelsolin (Fig. 5A), a pH-dependent actin severing and capping protein. Although regulation of the microtubule-based cytoskeleton by NHE1 and pHi have previously not been reported, a number of microtubule-related genes, including Clip 170, KIF4, kinesin light chain, and a dynein heavy chain, were upregulated in LAPE cells.
Consistent with NHE1-dependent cell adhesion and migration, LAPE cells had a marked (~26-fold) decrease in type IV collagenase (MMP-9) expression, and zymography confirmed that activity of MMP-9, but not activity of MMP-4, was selectively decreased in LAPE cells compared with LAPN cells (Fig. 5B). Correlating with a decrease in MMP-9 expression, LAPE cells also had similar marked (~24-fold) decrease in the expression of lipocalin 24p3, which was confirmed by TaqMan analysis (Fig. 5C). NGAL (Neutrophil Gelatinase Associated Lipocalin), the human homolog of mouse lipocalin, is covalently bound to MMP-9 and protects MMP-9 from degradation [49,50]. Lipocalins are transcriptionally regulated by C/EBPβ [51], which is likely suppressed by decreased expression of C/EBPδ (Fig. 2C) and increased expression of GADD153 (Fig. 2D). Moreover, increased expression of MMP-9 [52] and lipocalins [53] is associated with tumor cell growth and invasion, which correlates with a role for NHE1 activity in these processes [14,15].
Conclusions
In summary, global profiling revealed genes regulated by loss of NHE1 activity and decreased pHi. A number of the differentially regulated genes involved in growth factor signaling, cell cycle progression, and cytoskeleton and extracellular matrix remodeling are consistent with previously established roles of NHE1 activity and pHi in mitogenic responses, cell proliferation, and tumor metastasis and invasion. In contrast, some genes, including those regulating carbohydrate metabolism and microtubule dynamics, have previously not been linked to NHE1 activity. An important future direction is to determine primary and secondary effects of gene regulation by NHE1 and of particular interest is whether promoters within the genes differentially regulated in LAPE cells are pH-responsive.
Methods
Cell culture and RNA preparation
The generation of LAPN and LAPE cells was as previously described [5]. In brief, NHE1-null LAP1 cells developed from parental Ltk-mouse muscle fibroblasts [16] were used for stable expression of wild-type NHE1 (LAPN cells) or expression of NHE1-E266I containing a single point substitution of glutamate266 for isoleucine that results in complete loss of ion translocation activity (LAPE) [5,6]. Cells were maintained in DMEM supplemented with 10% FCS in the presence of 25 mM NaHCO3 and 5% CO2. Total RNA was prepared from cells plated for 48 h by using Qiagen's RNeasy® midi kit.RNA. RNA was collected from five independent cell platings and used for five separate DNA array hybridizations.
cDNA synthesis and microarray hybridization
Total RNA was converted to double-stranded cDNA using the SuperScript Choice system (Gibco BRL), except that HPLC-purified T7-(dT)24 oliomer (5'-GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGG – (dT)24) was used instead of the oligo (dT) or random primers provided with the SuperScript Choice kit. Double-stranded cDNA was collected by ethanol precipitation. Biotinylated cRNA was then generated from the cDNA by an in vitro transcription (IVT) reaction using the ENZO BioArray™ HighYield™ RNA Transcript Labeling Kit. IVT products (cRNA) were collected by using Qiagen's RNeasyR mini kit, then ethanol-precipitated and quantitated. The cRNA was fragmented by alkaline treatment and hybridized to a GeneChip probe array from Affymetrix (Santa Clara, CA). The Affymetrix murine oligonucleotide array (Mu11KSubB) is complementary to ~6,500 murine genes and expressed sequence tags (ESTs). Each gene or EST is represented on the array by 16 – 20 feature pairs. Each feature pair contains a 25-bp oligonucleotide sequence, which is either a perfect match to the gene or a single central-base hommomeric mismatch control.
Microarray hybridization analysis
Affymetrix GeneChip analysis was performed using standard procedures [54]. The expression level of any particular transcript was calculated by subtracting he difference between the fluorescence intensities of the perfect match and mismatch feature pairs and then averaging over the entire probe set (Avg Diff). The Avg Diff value for each transcript was averaged over the five experiments for LAPN and LAPE cells; these average values obtained from five independent hybridizations were then used to calculate fold changes in LAPE cells relative to LAPN cells for each transcript. We did not use comparison algorithms supplied with the Affymetrix software.
Immunoblot analysis
Proteins from total cell lysates were separated by SDS-PAGE as previously described [5] and transferred to PVD nitrocellulose membranes for immunoblotting. Antibodies for immunoblotting included Fyn (NeoMarkers), PLCγ-1 and Erk 1–2 (Cell Signaling), GADD45, FEN1, and cyclin B1 (Santa Cruz Biotechnology), and actin (Sigma).
TaqMan™ analysis
Confirmation of GeneChip data was accomplished using TaqMan™ chemistry with the ABI 7700 Prism real-time PCR instrument (ABI, Foster City CA). Custom primers specific to the genes of interest were synthesized by Life Technologies and TaqMan™ probes for each gene were synthesized by Integrated DNA Technologies, Inc. The forward and reverse primers for mouse GADD153 (GenBank accession no. X67083) were 5'-GAAACGAAGAGGAAGAATCAAAAAC-3' and 5'-ATCTGGAGAGCGAGGGCTTT-3', respectively, and the probe was 5'-FAM/ACCCTGCGTCCCTAGCTTGGCTGAC/TAM-3', corresponding to an amplicon of 122 bp. The forward and reverse primers for mouse Wee1 kinase (GenBank accession no. NM_009516) were 5'-TTGCTCTTGCTCTCACAGTCGT-3' and 5'-TGGGAAAGCACTTGTGGGAT-3', respectively, and the probe was 5'-FAM/CCTTCCCAGAAATGGAGAGCACTGGC/TAM-3', corresponding to an amplicon of 118 bp. The forward and reverse primers for mouse Glut4 (GenBank accession no. NM_009204) were 5'-TGGCCATCTTCTCTGTGGGT-3' and 5'-ATTGGCTAGGCCCATGAGG-3', respectively, and the probe was 5'-FAM/TATGCTGGCCAACAATGTCTTGGCC/TAM-3', corresponding to an amplicon of 138 bp. The forward and reverse primers for mouse 24p3 (GenBank accession no. W13166) were 5'-GGCAGCTTTACGATGTACAGCA-3' and 5'-TCTGATCCAGTAGCGACAGCC-3', respectively, and the probe was 5'-FAM/CATCCTGGTCAGGGACCAGGACCAG/TAM-3', corresponding to an amplicon of 111 bp. For each gene, PCR was conducted in triplicate with 50 μl reaction volumes of 1x PCR buffer A (Applied Biosystems, Foster City, CA), 2.5 mM MgCl2, 0.4 μM each primer, 200 μM each dNTP, 100 nM probe and 0.025 u/μl Taq Gold (ABI, Foster City CA). For each experiment, a large master mix of the above components was made and aliquoted into each optical reaction tube. Each primer/probe set (5 – 10 μl) was then added, and PCR conducted using the following cycle parameters: 95°C 12 min × 1 cycle, (95°C 20 sec, 60°C 1 min) × 40 cycles. Data analysis was carried out using sequence detection software that calculates the threshold cycle (Ct) for each reaction which is used to quantitate the amount of starting template in the reaction. A difference in Ct values (ΔCt) was calculated for each gene by taking triplicate Ct values from three reactions and subtracting the mean Ct of the triplicates for the control gene, GAPDH, for each cDNA sample at the same concentration. An additional difference in Ct values (ΔCt) was calculated for each gene by taking the triplicate ΔCt values for each gene in the mutant LAPN1-E266I cells and subtracting the mean ΔCt of the triplicates for the wild-type LAPN cells. The relative expression levels were calculated as = 2 -ΔΔCt [55].
Quantitative RT-PCR analysis
Relative quantitative RT-PCR was preformed using QuantumRNA™ 18S internal standards from Ambion, Inc. (Austin TX) that included 18S Primers and Competimers™. By optimizing the assay and choosing an appropriate18S Primer:Competimer ratio for each sample, the 18S signal was reduced to the same linear range as that identified empirically for the gene specific product. The amplicon for the 18S primers was 315 bp. Custom primers specific to the genes of interest were synthesized by Life Technologies. The forward and reverse primers for calpactin I light chain (GenBank accession no. M16465) were 5'-GTGGACAAAATAATGAAGGAC-3' and 3'-ACAAGAAGCAGTGGGGCAGAT-5', respectively, corresponding to an amplicon of 222 bp. The forward and reverse primers for CEBPδ (GenBank accession no. NM_007679.1) were 5'-ATACCTCAGACCCCGACAGCG-3' and 3'-CAAAAGTCTGTCGGAAATGTC-5', respectively, corresponding to an amplicon of 220 bp. Total RNA was isolated from LAPN1 and LAPN1-E266I cells in four separate experiments, using Qiagen's RNeasy® midi kit. Reverse transcription of total RNA from each sample was carried out using random decamers and the RETROscript™ kit from Ambion. RT reactions were then subjected to PCR using the gene specific primers above (final concentration of 0.4 uM each), the appropriate 18S
Primer:Competimer ratio and 10uCi/ul [α-32P]dCTP for labeling. PCR was conducted using the following cycle parameters: (94°C 30 sec, 57°C 30 sec, 72°C 30 sec) × 21 cycles for CEBPδ and 19 cycles for calpactin I light chain. Empirically derived 18S Primer:Competimer ratios were 1:18 for CEBPδ and 2:8 for calpactin I light chain.
Zymography
Activity of type IV collagenase (MMP9) was determined by zymography, as previously described [56].
Abbreviations
Ezrin, radixin, moesin (ERM); Intracellular pH (pHi), Na-H exchanger type 1 (NHE1); NGAL (Neutrophil Gelatinase Associated Lipocalin); type IV collagenase (MMP-9).
Authors' contributions
LP participated in the design of the study, prepared and analyzed samples for array analysis, conducted analyses for protein and RNA expression, and performed the statistical analysis. DB conceived of the study, conducted analyses for protein expression, and participated in the design and coordination of the study. LP and DB prepared the manuscript.
Acknowledgements
We thank members of the Zena Werb laboratory at UCSF for assistance with zymography for MMP-9, and Lauren Ellis for help in preparing the manuscript. This work was supported by National Institutes of Health grant GM47413.
References
-
Serrano R, Ruiz A, Bernal D, Chambers JR, Arino J: The transcriptional response to alkaline pH in Saccharomyces cerevisiae: evidence for calcium-mediated signalling.
Mol Microbiol 2002, 46:1319-1333. PubMed Abstract | Publisher Full Text
-
Olson ER: Influence of pH on bacterial gene expression.
Mol Microbiol 1993, 8:5-14. PubMed Abstract
-
Putney LK, Denker SP, Barber DL: The changing face of the Na+/H+ Exchanger, NHE1: Structure, regulation, and cellular actions. In Annu Rev Pharmacol Toxicol. Volume 42. Edited by Schekman R, Goldstein LB, McKnight SL, Rossant J. Palo Alto; 2002:527-552. Publisher Full Text
-
Orlowski J, Grinstein S: Diversity of the mammalian sodium/proton exchanger SLC9 gene family.
Pflugers Arch 2004, 447:549-565. PubMed Abstract | Publisher Full Text
-
Putney LK, Barber DL: Na-H Exchange-dependent increase in intracellular pH times G2/M entry and transition.
J Biol Chem 2003, 278:44645-44649. PubMed Abstract | Publisher Full Text
-
Denker SP, Huang DC, Orlowski J, Furthmayr H, Barber DL: Direct binding of the Na--H exchanger NHE1 to ERM proteins regulates the cortical cytoskeleton and cell shape independently of H(+) translocation.
Mol Cell 2000, 6:1425-1436. PubMed Abstract | Publisher Full Text
-
Kapus A, Grinstein S, Wasan S, Kandasamy R, Orlowski J: Functional characterization of three isoforms of the Na+/H+ exchanger stably expressed in Chinese hamster ovary cells. ATP dependence, osmotic sensitivity, and role in cell proliferation.
J Biol Chem 1994, 269:23544-23552. PubMed Abstract | Publisher Full Text
-
Rich IN, Worthington-White D, Garden OA, Musk P: Apoptosis of leukemic cells accompanies reduction in intracellular pH after targeted inhibition of the Na(+)/H(+) exchanger.
Blood 2000, 95:1427-1434. PubMed Abstract | Publisher Full Text
-
Denker SP, Barber DL: Cell migration requires both ion translocation and cytoskeletal anchoring by the Na-H exchanger NHE1.
J Cell Biol 2002, 159:1087-1096. PubMed Abstract | Publisher Full Text
-
Tominaga T, Barber DL: Na-H exchange acts downstream of RhoA to regulate integrin-induced cell adhesion and spreading.
Mol Biol Cell 1998, 9:2287-2303. PubMed Abstract | Publisher Full Text
-
Ritter M, Schratzberger P, Rossmann H, Woll E, Seiler K, Seidler U, Reinisch N, Kahler CM, Zwierzina H, Lang HJ, Lang F, Paulmichl M, Wiedermann CJ: Effect of inhibitors of Na+/H+-exchange and gastric H+/K+ ATPase on cell volume, intracellular pH and migration of human polymorphonuclear leucocytes.
Br J Pharmacol 1998, 124:627-638. PubMed Abstract | Publisher Full Text
-
Bussolino F, Wang JM, Turrini F, Alessi D, Ghigo D, Costamagna C, Pescarmona G, Mantovani A, Bosia A: Stimulation of the Na+/H+ exchanger in human endothelial cells activated by granulocyte- and granulocyte-macrophage-colony-stimulating factor. Evidence for a role in proliferation and migration.
J Biol Chem 1989, 264:18284-18287. PubMed Abstract | Publisher Full Text
-
Kaplan DL, Boron WF: Long-term expression of c-H-ras stimulates Na-H and Na(+)-dependent Cl-HCO3 exchange in NIH-3T3 fibroblasts.
J Biol Chem 1994, 269:4116-4124. PubMed Abstract | Publisher Full Text
-
Reshkin SJ, Bellizzi A, Caldeira S, Albarani V, Malanchi I, Poignee M, Alunni-Fabbroni M, Casavola V, Tommasino M: Na+/H+ exchanger-dependent intracellular alkalinization is an early event in malignant transformation and plays an essential role in the development of subsequent transformation-associated phenotypes.
FASEB J 2000, 14:2185-2197. PubMed Abstract | Publisher Full Text
-
Pouyssegur J, Franchi A, Pages G: pHi, aerobic glycolysis and vascular endothelial growth factor in tumour growth.
Novartis Found Symp 2001, 240:186-196.
discussion 196-188
PubMed Abstract -
Pouysségur J, Sardet C, Franchi A, L'Allemain G, Paris S: A specific mutation abolishing Na+/H+ antiport activity in hamster fibroblasts precludes growth at neutral and acidic pH.
Proc Natl Acad Sci USA 1984, 81:4833-4837. PubMed Abstract | Publisher Full Text
-
Franchi A, Perucca-Lostanlen D, Pouyssegur J: Functional expression of a human Na+/H+ antiporter gene transfected into antiporter-deficient mouse L cells.
Proc Natl Acad Sci USA 1986, 83:9388-9392. PubMed Abstract | Publisher Full Text
-
Whitfield ML, Sherlock G, Saldanha AJ, Murray JI, Ball CA, Alexander KE, Matese JC, Perou CM, Hurt MM, Brown PO, Botstein D: Identification of genes periodically expressed in the human cell cycle and their expression in tumors.
Mol Biol Cell 2002, 13:1977-2000. PubMed Abstract | Publisher Full Text
-
Nakao M, Bono H, Kawashima S, Kamiya T, Sato K, Goto S, Kanehisa M: Genome-scale Gene Expression Analysis and Pathway Reconstruction in KEGG.
Genome Inform Ser Workshop Genome Inform 1999, 10:94-103. PubMed Abstract | Publisher Full Text
-
Doniger SW, Salomonis N, Dahlquist KD, Vranizan K, Lawlor SC, Conklin BR: MAPPFinder: using Gene Ontology and GenMAPP to create a global gene-expression profile from microarray data.
Genome Biol 2003, 4:R7. PubMed Abstract | BioMed Central Full Text
-
Rhoden KJ, Dodson AM, Ky B: Stimulation of the Na(+)-K(+) pump in cultured guinea pig airway smooth muscle cells by serotonin.
J Pharmacol Exp Ther 2000, 293:107-112. PubMed Abstract | Publisher Full Text
-
Yan W, Nehrke K, Choi J, Barber DL: The Nck-interacting kinase (NIK) phosphorylates the Na+-H+ exchanger NHE1 and regulates NHE1 activation by platelet-derived growth factor.
J Biol Chem 2001, 276:31349-31356. PubMed Abstract | Publisher Full Text
-
Hooley R, Yu CY, Symons M, Barber DL: G alpha 13 stimulates Na+-H+ exchange through distinct Cdc42-dependent and RhoA-dependent pathways.
J Biol Chem 1996, 271:6152-6158. PubMed Abstract | Publisher Full Text
-
Ma YH, Reusch HP, Wilson E, Escobedo JA, Fantl WJ, Williams LT, Ives HE: Activation of Na+/H+ exchange by platelet-derived growth factor involves phosphatidylinositol 3'-kinase and phospholipase C gamma.
J Biol Chem 1994, 269:30734-30739. PubMed Abstract | Publisher Full Text
-
Aharonovitz O, Granot Y: Stimulation of mitogen-activated protein kinase and Na+/H+ exchanger in human platelets. Differential effect of phorbol ester and vasopressin.
J Biol Chem 1996, 271:16494-16499. PubMed Abstract | Publisher Full Text
-
Bianchini L, L'Allemain G, Pouyssegur J: The p42/p44 mitogen-activated protein kinase cascade is determinant in mediating activation of the Na+/H+ exchanger (NHE1 isoform) in response to growth factors.
J Biol Chem 1997, 272:271-279. PubMed Abstract | Publisher Full Text
-
van Dam H, Castellazzi M: Distinct roles of Jun : Fos and Jun : ATF dimers in oncogenesis.
Oncogene 2001, 20:2453-2464. PubMed Abstract | Publisher Full Text
-
Cao Z, Umek RM, McKnight SL: Regulated expression of three C/EBP isoforms during adipose conversion of 3T3-L1 cells.
Genes Dev 1991, 5:1538-1552. PubMed Abstract
-
Lane MD, Tang QQ, Jiang MS: Role of the CCAAT enhancer binding proteins (C/EBPs) in adipocyte differentiation.
Biochem Biophys Res Commun 1999, 266:677-683. PubMed Abstract | Publisher Full Text
-
Maytin EV, Habener JF: Transcription factors C/EBP alpha, C/EBP beta, and CHOP (Gadd153) expressed during the differentiation program of keratinocytes in vitro and in vivo.
J Invest Dermatol 1998, 110:238-246. PubMed Abstract | Publisher Full Text
-
Sok J, Wang XZ, Batchvarova N, Kuroda M, Harding H, Ron D: CHOP-Dependent stress-inducible expression of a novel form of carbonic anhydrase VI.
Mol Cell Biol 1999, 19:495-504. PubMed Abstract | Publisher Full Text
-
Ubeda M, Wang XZ, Zinszner H, Wu I, Habener JF, Ron D: Stress-induced binding of the transcriptional factor CHOP to a novel DNA control element.
Mol Cell Biol 1996, 16:1479-1489. PubMed Abstract | Publisher Full Text
-
Jean S, Bideau C, Bellon L, Halimi G, De Meo M, Orsiere T, Dumenil G, Berge-Lefranc JL, Botta A: The expression of genes induced in melanocytes by exposure to 365-nm UVA: study by cDNA arrays and real-time quantitative RT-PCR.
Biochim Biophys Acta 2001, 1522:89-96. PubMed Abstract | Publisher Full Text
-
Zhang Z, Yang XY, Cohen DM: Urea-associated oxidative stress and Gadd153/CHOP induction.
Am J Physiol 1999, 276:F786-793. PubMed Abstract | Publisher Full Text
-
Tang JR, Nakamura M, Okura T, Takata Y, Watanabe S, Yang ZH, Liu J, Kitami Y, Hiwada K: Mechanism of oxidative stress-induced GADD153 gene expression in vascular smooth muscle cells.
Biochem Biophys Res Commun 2002, 290:1255-1259. PubMed Abstract | Publisher Full Text
-
Amanullah A, Azam N, Balliet A, Hollander C, Hoffman B, Fornace A, Liebermann D: Cell signalling: cell survival and a Gadd45-factor deficiency.
Nature 2003, 424:741.
discussion 742
PubMed Abstract | Publisher Full Text -
Jin S, Mazzacurati L, Zhu X, Tong T, Song Y, Shujuan S, Petrik KL, Rajasekaran B, Wu M, Zhan Q: Gadd45a contributes to p53 stabilization in response to DNA damage.
Oncogene 2003, 22:8536-8540. PubMed Abstract | Publisher Full Text
-
Prasad R, Dianov GL, Bohr VA, Wilson SH: FEN1 stimulation of DNA polymerase beta mediates an excision step in mammalian long patch base excision repair.
J Biol Chem 2000, 275:4460-4466. PubMed Abstract | Publisher Full Text
-
Kim K, Biade S, Matsumoto Y: Involvement of flap endonuclease 1 in base excision DNA repair.
J Biol Chem 1998, 273:8842-8848. PubMed Abstract | Publisher Full Text
-
Tom S, Henricksen LA, Bambara RA: Mechanism whereby proliferating cell nuclear antigen stimulates flap endonuclease 1.
J Biol Chem 2000, 275:10498-10505. PubMed Abstract | Publisher Full Text
-
Jaco I, Munoz P, Goytisolo F, Wesoly J, Bailey S, Taccioli G, Blasco MA: Role of mammalian Rad54 in telomere length maintenance.
Mol Cell Biol 2003, 23:5572-5580. PubMed Abstract | Publisher Full Text
-
Alexeev A, Mazin A, Kowalczykowski SC: Rad54 protein possesses chromatin-remodeling activity stimulated by the Rad51-ssDNA nucleoprotein filament.
Nat Struct Biol 2003, 10:182-186. PubMed Abstract | Publisher Full Text
-
Friedman AD: GADD153/CHOP, a DNA damage-inducible protein, reduced CAAT/enhancer binding protein activities and increased apoptosis in 32D c13 myeloid cells.
Cancer Res 1996, 56:3250-3256. PubMed Abstract
-
Maytin EV, Ubeda M, Lin JC, Habener JF: Stress-inducible transcription factor CHOP/gadd153 induces apoptosis in mammalian cells via p38 kinase-dependent and -independent mechanisms.
Exp Cell Res 2001, 267:193-204. PubMed Abstract | Publisher Full Text
-
Krek W, Nigg EA: Differential phosphorylation of vertebrate p34cdc2 kinase at the G1/S and G2/M transitions of the cell cycle: identification of major phosphorylation sites.
EMBO J 1991, 10:305-316. PubMed Abstract
-
Dang CV, Lewis BC, Dolde C, Dang G, Shim H: Oncogenes in tumor metabolism, tumorigenesis, and apoptosis.
J Bioenerg Biomembr 1997, 29:345-354. PubMed Abstract | Publisher Full Text
-
Vexler ZS, Symons M, Barber DL: Activation of Na+-H+ exchange is necessary for RhoA-induced stress fiber formation.
J Biol Chem 1996, 271:22281-22284. PubMed Abstract | Publisher Full Text
-
Yan L, Borregaard N, Kjeldsen L, Moses MA: The high molecular weight urinary matrix metallporoteinase (MMP) activity is a complex of gelatinase B/MMP-9 and neutrophil-associated lipocalin (NGAL). Modulation of MMP-9 activity by NGAL.
J Biol Chem 2001, 276:37258-37265. PubMed Abstract | Publisher Full Text
-
Tschesche H, Zolzer V, Triebel S, Bartsch S: The human neutrophil lippocalin supports the aoolisteric activativation of matrix metalloporteinases.
Eur J Biochem 2001, 268:1918-1928. PubMed Abstract | Publisher Full Text
-
Hartl M, Matt T, Schuler W, Siemeister G, Kontaxis G, Kloiber K, Konrat R, Bister K: Cell transformation by the v-myc oncogene abrogates c-Myc/Max-mediated suppression of a C/EBP beta-dependent lipocalin gene.
J Mol Biol 2003, 333:33-46. PubMed Abstract | Publisher Full Text
-
van Kempen LC, Rhee JS, Dehne K, Lee J, Edwards DR, Coussens LM: Epithelial carcinogenesis: dynamic interplay between neoplastic cells and their microenvironment.
Differentitation 2002, 70:610-623. Publisher Full Text
-
Bratt T: Lipocalins and cancer.
Biochim Biophys Acta 2000, 1482:318-326. PubMed Abstract | Publisher Full Text
-
Lockhart DJ, Dong H, Byrne MC, Follettie MT, Gallo MV, Chee MS, Mittmann M, Wang C, Kobayashi M, Horton H, Brown EL: Expression monitoring by hybridization to high-density oligonucleotide arrays [see comments].
Nat Biotechnol 1996, 14:1675-1680. PubMed Abstract
-
Ginzinger DG: Gene quantification using real-time quantitative PCR: an emerging technology hits the mainstream.
Exp Hematol 2002, 30:503-512. PubMed Abstract | Publisher Full Text
-
Behrendtsen O, Alexander CM, Werb Z: Metalloproteinases mediate extracellular matrix degradation by cells from mouse blastocyst outgrowths.
Development 1992, 114:447-456. PubMed Abstract