Figure 1.

A motivating example demonstrating how the use of a reference can help discover the most parsimonious traversal of the de Bruijn graph. (a) de Bruijn graph of the donor sequence "ATAGAGGCAATGAGCGTGGAGTTC". (b) de Bruijn graph of the reference sequence "ATAGCAATCGTGTTC", including edge index labels. (c) Graph combining the donor and reference sequences. (d) Graph stripped of red edges with no parallel blue edge.

Parrish et al. BMC Genomics 2013 14(Suppl 1):S8   doi:10.1186/1471-2164-14-S1-S8