Table 2

Set of 21 smRNAs (8 miRNAs and 13 siRNAs) that were independently identified over 9 experimental treatments and matched all criteria for smRNA identification
miRNA Sequence Length Stem-loop length MFE [kcalmol-1] Read count mature strand Read count star strand
smb107.2 CAAGGAUGGGAUGCUCAGAGAA 22 88 −69.3 13,315 398 (9)
smb107.3 CAAGGAUGGGAUGGUCAGAGAA 22 88 −64.1 3,322 398 (9)
smb123 CAGUCGGCCAAAGUGCUGGACC 22 89 −64.1 451 154 (9)
smb203 CUUUGUAUCCCGGAUCCUGAUA 22 87 −46.6 1,087 389 (9)
smb215 GAGGAUGCUGAUCAUUCACUGG 22 87 −80.6 85 34 (8)
smb295 UCAGAGACCAGACGCAGAGGCU 22 90 −40.6 12,543 160 (9)
smb297 UCAGUGGCAGAAGCUGGGAACU 22 87 −63.5 965 60 (8)
smb313 UCGAACUUUCAGGAAUAGUAUC 22 87 −54.8 2,707 1475 (9)
siRNA Sequence Length Stem-loop length MFE [kcalmol-1] Read count mature strand Read count star strand
smb21 AAUUUGAACGUUGCCAUCUAUC 22 87 −72.5 123 9 (7)
smb41 ACCUGCAGCAUUUGGCGCCUGA 22 84 −77.9 299 18 (7)
smb51 ACUUAGAACUCUCCUACGAGGG 22 88 −83.1 510 275 (8)
smb79 AGUUGGACCAGACCAGUUGGUC 22 87 −71.7 489 319 (9)
smb83 AUCACUCCACAAAGGGAUUUG 21 87 −65.5 217 7 (5)
smb101 CAACGAGAUUGGCCUUCUGUGC 22 87 −82.9 5,234 412 (9)
smb163 CGGGACUCGAUUCGGAGGGUGC 22 88 −63.6 2,015 660 (9)
smb271 UAGAAUGUAGUCGUCAUCUUGC 22 88 −68.9 1,044 29 (9)
smb303 UCCGCCGUGCAACUGUCGCAAC 22 88 −80.2 207 107 (9)
smb359 UGAUGUACAUCGAUUGAUCGAC 22 86 −63.8 646 23 (9)
smb365 UGCCAACGUGAUUUGCAACUCC 22 84 −68.1 333 75 (7)
smb379 UGGACUUGGAAAGCUUCUCUGC 22 86 −76.7 2,505 2 (2)
smb427 UUUGUCCAGUGUACCUGCGCU 21 85 −73 728 50 (8)

Read counts for guide and passenger strands were derived by pooling counts over conditions. The number of experimental treatments that identified the passenger strand is indicated in brackets. MFE = Minimum Free Energy of precursor.

Baumgarten et al.

Baumgarten et al. BMC Genomics 2013 14:704   doi:10.1186/1471-2164-14-704

Open Data