Table 3

Primer sets used for qRT-PCR analysis of the selected candidate genes upon aphid feeding on wheat plants and in vitro dsRNA synthesis of 16 candidates
Unigene no. Forward primer Reverse primer
Unigene_6994
    TAATACGACTCACTATAGGG
AGCTGAAAAGTGAAATGATGGTGGTC
    TAATACGACTCACTATAGGG
TTGCCAAACTGGAAAATCG
Unigene_ 8273
    TAATACGACTCACTATAGGG
AGTGCGTCAGATAGTCCGGCACC
    TAATACGACTCACTATAGGG
CACCATTCAAATCCGTTTCTTACAGC
Unigene_ 8279
    TAATACGACTCACTATAGGG
AGAAAGCAATGCTGTGGCAGAAAC
    TAATACGACTCACTATAGGG
GTGGTCGTTCTTTCAGTGATGG
Unigene_11975
    TAATACGACTCACTATAGGG
AGCGCTGTTGGTGCTGGTGGTGATG
    TAATACGACTCACTATAGGG
TCGTTGGACGGTTTGGTCGATGTCT
Unigene_21088
    TAATACGACTCACTATAGGG
AGGTTTAACGAATCGGACCATCAGGAA
    TAATACGACTCACTATAGGG
AAAATATGATCGCCTCAAGGGGACT
Unigene_21789
    TAATACGACTCACTATAGGG
AGTACCGTCCGCAAATGGTTGG
    TAATACGACTCACTATAGGG
TCCGAAGTCACATGTTCGCA
Unigene_23028
    TAATACGACTCACTATAGGG
AGGTTATTGTTGAACCCTTCTGACACG
    TAATACGACTCACTATAGGG
GAAGGATTAGACGATATTTTGGTG
Unigene_23042
    TAATACGACTCACTATAGGG
AGGTTCCATGACAAGCCGGATAC
    TAATACGACTCACTATAGGG
GACTCAAGTGCCTGGTGGGT
Unigene_23235
    TAATACGACTCACTATAGGG
AGGGTGCCCGACTCGGTTTTCTCC
    TAATACGACTCACTATAGGG
GCTGCCCAAGCCAACATCCAC
Unigene_26956
    TAATACGACTCACTATAGGG
AGCCGTGATTCTCCTGCGTCTGCT
    TAATACGACTCACTATAGGG
AGTCTTCGCCACCGCCGTTT
Unigene_27357
    TAATACGACTCACTATAGGG
AGATGGTTTTATGGTTGGCTTTAGTCCAG
    TAATACGACTCACTATAGGG
CCGCGTTCGCATTTCGTTTT
Unigene_27882
    TAATACGACTCACTATAGGG
AGAGGTATCACCCGCCGTACC
    TAATACGACTCACTATAGGG
GAACAGCTGGTTCTGCGAAA
Unigene_28447
    TAATACGACTCACTATAGGG
AGTGGCCCGTACGACACACCGA
    TAATACGACTCACTATAGGG
CGGACGATGTGCCGGGTGAC
Unigene_28469
    TAATACGACTCACTATAGGG
AGCAAATGAAACGCCGTATTTGATAA
    TAATACGACTCACTATAGGG
CGTGCCTACCGTATTCGACAAT
Unigene_28555
    TAATACGACTCACTATAGGG
AGGGGTTAGACTTGCCCGAAACTGATG
    TAATACGACTCACTATAGGG
TCCATGTTGGCAGTCCAACCGT
Unigene_29698
    TAATACGACTCACTATAGGG
AGCGTCGCCTTGGTGAGCCTTTAC
    TAATACGACTCACTATAGGG
CGGCGGACGGGTGAGTAATG
Actin CCGAAAAGCTGTCATAATGAAGACC GGTGAAACCTTGTCTACTGTTACATCTTG
GFP
    TAATACGACTCACTATAGGG
AGGCAGTGCTTCAGCCGCTACCC
    TAATACGACTCACTATAGGG
CCTTGATGCCGTTCTTCTGCTTGTC

Note: T7 promoter sequences were tailed to each 5’ end of primers and underlined. The sequences without T7 promoter sequence tails were used for qRT-PCR analysis of the selected candidate genes upon aphid feeding on wheat plants.

Zhang et al.

Zhang et al. BMC Genomics 2013 14:560   doi:10.1186/1471-2164-14-560

Open Data