Table 3

Primer sequences, melting temperatures and product sizes for twelve immunogenes in the qPCR analysis
Gene symbol Primer sequence (5'-3') Target size (bp) Tm (°C)
ADAM17 Sense: TGGCAGACAACATCGTGGG 106 59
Anti-sense: GGGCTTGATGATGCGAACG
ARG2 Sense: GCATTCCGCCCCGAAG 233 65
Anti-sense:CCACTGAGCGAGGATTCACT
C1R Sense: TGTGGACCTGGATGAATGT 101 59
Anti-sense: AATAGCCGCCGATGTAGTT
CFB Sense: CATTCATGATATTCGGGACCT 92 59
Anti-sense: GCCCAACCCCAAACACGTA
CD1D Sense: GTGGCTCCTCTACGACATCT 88 55
Anti-sense: TTCAGGCTTCACTTGCTTCTC
BCL6 Sense: TTGTCATAGTGGTGAGCCGAGAG 168 65
Anti-sense: TGAAGTCCAGGAGGATGCAGAAC
ADM Sense: CGCTACCGCCAGAGTATGAACA 121 59
Anti-sense: CGTCCTTGTCTTTGTCCGTGAAC
IFIT1 Sense: AATTAGCCACAGGTCATT 144 55
Anti-sense: ATTCCATACACAACACTCT
ASHA2 Sense: AATCTCCTGCTATATTAGAAG 126 55
Anti-sense: AGTTCCTACATCTCCATT
PAK1 Sense: CACTTCCTATTACTCCAACT 113 59
Anti-sense: CTTCTTCTTCTGCTTCTCA
ST6GAL1 Sense: GACATCATTCAAGAAATCTC 164 59
Anti-sense: AAGAACTTCTGGTAGTAGTA
RPL32 a Sense: CGGAAGTTTCTGGTACACAATGTAA 94 55-65
Anti-sense: TGGAAGAGACGTTGTGAGCAA

a The transcript levels of RPL13 were used for sample normalization.

Zhao et al.

Zhao et al. BMC Genomics 2013 14:46   doi:10.1186/1471-2164-14-46

Open Data